Ciliary and non-ciliary functions of Bardet-Biedl Syndrome proteins Doctoral thesis submitted in partial fulfilment of the requirements for the academic degree Doctor rerum naturalium at the faculty of biology Johannes Gutenberg University Mainz Lena Brücker Mainz, April 2022 Dean: 1. Referee: Univ.-Prof. Dr. Helen Louise May-Simera Institute of Molecular Physiology 2. Referee: Date of the oral examination: 21.07.2022 II Annotation Annotation The present thesis is written in a cumulative way and consists of the following publications: Patnaik SR, Farag A, Volz AK, Brücker L, Schneider S, Kretschmer V, May-Simera HL (2020): Tissue dependent differences in Bardet-Biedl Syndrome gene expression. Biol Cell; 112(2):39-52 (Publication I) Patnaik SR, Kretschmer V, Brücker L, Schneider S, Volz AK, Oancea-Castillo LDR, May- Simera HL (2019): Bardet-Biedl Syndrome proteins regulate cilia disassembly during tissue maturation. Cell Mol Life Sci; 76(4):757-775 (Publication II) Brücker L, Becker SK, Harms G, Parsons M, May-Simera HL: The actin-bundling protein Fascin-1 modulates ciliary signalling. (Manuscript I) Brücker L, Kretschmer V, May-Simera HL (2020): The entangled relationship between cilia and actin. Review. IJBCB; 129: 105877 (Publication III) Manuscript I was submitted in February 2022 at Journal of Molecular Cell Biology and is currently being revised. Additional data not included in this manuscript are shown in section 3.3. Publication III represents a literature review on the topic of primary cilia and actin. Contribution to the Publications I and II and Manuscript I are described in detail in the supplementary data of this thesis. III Annotation Contribution to further publications The following publication is not part of this thesis but has also been contributed to: Nguyen VTT, Brücker L, Volz AK, Baumgärtner JC, Dos Santos Guilherme M, Valeri F, May-Simera H, Endres K (2021): Primary cilia structure is prolonged in enteric neurons of 5xFAD Alzheimer’s disease model mice. Int J Mol Sci; 22: 13564 Contribution to conferences Parts of this thesis have been presented on the listed conferences in form of a presentation or poster: Brücker L, Volz AK, May-Simera HL (2021): Forschungsupdate zu Zilien und Zellmigration. Presentation. National meeting of the German BBS patient society, Essen, Germany Brücker L, Parsons M, May-Simera HL (2019): Cilia protein regulation of actin dynamics. Poster. 2019 ASCB/EMBO Meeting, Washington D.C., USA Brücker L (2019): Cilia – the navigation system of the cell. Presentation. 4th Interdisciplinary Symposium, Mainz, Germany Brücker L & Volz AK (2019): DNA – Der Baustein des Lebens. Presentation. National meeting of the German BBS patient society, Essen, Germany Brücker L, Patnaik SR, May-Simera HL (2018): Ciliary regulation of Wnt signalling molecules during cell migration. Poster. International Meeting of the German Society for Cell Biology (DGZ), Leipzig, Germany IV Content Index of Contents 1. Introduction ............................................................................................................................ 1 1.1. Primary Cilia ................................................................................................................... 1 1.1.1. Primary ciliogenesis ................................................................................................. 2 1.1.2. Actin during ciliogenesis .......................................................................................... 3 1.2. Ciliopathies ...................................................................................................................... 6 1.2.1. The Bardet-Biedl syndrome ..................................................................................... 7 1.2.1.1. BBS protein functions ....................................................................................... 7 1.2.1.2. Actin-related BBS protein functions ............................................................... 11 1.3. Wnt signalling ............................................................................................................... 13 1.3.1. Ciliary regulation of Wnt signalling ....................................................................... 15 1.3.2. BBS proteins in Wnt signalling .............................................................................. 16 1.4. Objectives ...................................................................................................................... 17 2. Publications and Manuscripts ............................................................................................... 19 3. Discussion ............................................................................................................................ 24 3.1. Investigation of potential tissue-dependent regulations of BBS proteins ..................... 24 3.1.1. Tissue-dependent differences in expression of the BBSome subunits ................... 25 3.1.2. Tissue-dependent differences in expression of the chaperonin-like Bbs genes ..... 26 3.1.3. Conclusion and outlook .......................................................................................... 27 3.2. Involvement of ciliary BBS proteins in Wnt signalling ................................................ 29 3.2.1. BBS proteins interact with Inversin in regulating Wnt signalling ......................... 30 3.2.2. BBS proteins affect Wnt signalling via regulation of β-catenin levels .................. 30 3.2.3. Conclusion and outlook .......................................................................................... 32 3.3. Interplay between primary cilia and the actin network ................................................. 34 3.3.1. The ciliary protein Bbs6 regulates filopodia length ............................................... 35 3.3.2. Regulation of Fascin-1 in ciliogenesis ................................................................... 36 3.3.3. Fascin-1 regulates cilia-related PCP signalling ...................................................... 37 V Content 3.3.4. Downstream regulation of PCP signalling on actin networks ................................ 38 3.3.5. Conclusion and outlook .......................................................................................... 41 4. Final conclusion and remarks ............................................................................................... 44 5. Summary .............................................................................................................................. 45 6. German summary ................................................................................................................. 46 7. References ............................................................................................................................ 48 8. Supplements ......................................................................................................................... 71 VI Introduction 1. Introduction Primary cilia are microtubule-based organelles important for various aspects of cell and tissue homeostasis. Similar to signalling antennae, they transmit and receive cues from and to other cells and regulate several intracellular signalling pathways. Thus, defects in primary cilia and ciliary development are associated with numerous human genetic disorders, collectively termed ciliopathies. Besides regulating cilia development, maintenance and trafficking, ciliary proteins have been suggested to coordinate other important functions inside the cell such as cell cycle progression (Delaval et al., 2011; Wood et al., 2012), proteasomal degradation (Gerdes et al., 2007; Kudryashova et al., 2005; Liu et al., 2014), DNA damage response (O’Regan et al., 2007), transcriptional regulation (Gascue et al., 2012), intracellular trafficking (Finetti et al., 2009; Leitch et al., 2014; May-Simera et al., 2015; Yen et al., 2006), and regulation of the cytoskeleton and cell migration (Hernandez-Hernandez et al., 2013; J. Kim et al., 2010; May- Simera et al., 2016; Yin et al., 2009). The current work aims to obtain a deeper understanding of the ciliary and non-ciliary functions of ciliary proteins to expand our knowledge of the complex molecular mechanisms underlying human ciliopathies. 1.1. Primary Cilia Cilia are highly conserved cell organelles that can be found on many eukaryotic cell types. They are required for locomotion of cells such as ciliates or sperm cells, for fluid-flow over membranes for example in the respiratory epithelium, or for the exchange of signals and thus communication between cells. Primary cilia are found singularly on cells, whereas motile cilia can be abundant in large numbers per cell. Since they cannot move, primary cilia are important for inter- and intracellular communication of cells, thus often involved in organ and tissue development (Anvarian et al., 2019). Although motile cilia are structurally different from primary cilia as they require more stability to enable movement, both cilia types are able to receive and transduce cellular signals and are thus also involved in the regulation of different intracellular signalling pathways (Satir and Christensen, 2007). Some cells can have very specialised primary cilia such as photoreceptor cells in the mammalian retina (May-Simera et al., 2017). 1 Introduction 1.1.1. Primary ciliogenesis Primary cilia are anchored to the cell via the basal body, originally derived from the mother centriole, which consists of nine microtubule triplets organised in a ring-like formation (Fig. 1). Upon exit of the cell cycle, the mother centriole undergoes various stages of maturation and docks at the plasma membrane. As opposed to the extracellular way, the intracellular process of ciliogenesis (visualised in Fig. 1) is initiated via docking of preciliary vesicles at the distal end of the mother centriole (Schmidt et al., 2012; Wu et al., 2018). The ciliary vesicle is formed via fusion of distal appendage vesicles, further remodelling and maturing the mother centriole (Lu et al., 2015; Sorokin, 1968). Via extension of the inner microtubule doublets (the A- and B-tubule) of the basal body within the sheath of the ciliary vesicle, the nascent primary cilium is formed, which docks at the plasma membrane (Sánchez and Dynlacht, 2016). Distal appendages anchor the ciliary basal body at the plasma membrane, whereas subdistal appendages are needed to connect it to the intracellular microtubule network (Huang et al., 2017). Focal adhesion complexes further attach the basal body to the actin cytoskeleton (Antoniades et al., 2014). After docking at the plasma membrane, ciliary proteins and components of the intraflagellar transport machinery (IFT) are recruited to the cilium via distal appendages which enable elongation of the ciliary axoneme (Yang et al., 2018). Thus, the ciliary axoneme protrudes from the cell surface and is able to receive and transduce signals. The thickness of the axoneme reduces concomitantly from the base to the ciliary tip which is accompanied by migration of microtubules into the axonemal centre, thus the axonemal microtubule structure dissolves from the traditional ring-like formation (Kiesel et al., 2020). Additionally, some of the B-tubules are not elongated towards the ciliary tip and often terminate within the first third of the axoneme (Kiesel et al., 2020). The microtubules provide structure and stability for the ciliary axoneme and serve as a track for the intraflagellar transport machinery. This machinery consists of specialised IFT trains that are, together with dynein and kinesin motor proteins, required for bidirectional transport of proteins and vesicles into and out of the cilium, consequently enabling its assembly and disassembly (Nozaki et al., 2019; Wei et al., 2012). The IFT trains are organised at the transition zone between the basal body and the axoneme, which serves as a size-dependent diffusion barrier regulating protein cargo into and out of the cilium (Kee et al., 2012). The specifically regulated trafficking of signalling receptors and proteins into and out of the axoneme maintains the ciliary function as a specialised signalling hub. 2 Introduction Fig. 1: The intracellular process of ciliogenesis. During ciliogenesis, preciliary vesicles dock at the mother centriole, inducing its maturation. Fusion of the preciliary vesicles result in the formation of the ciliary vesicle. Elongation of microtubule doublets lead to the development of a nascent primary cilium that docks at the plasma membrane via distal appendages (DA) and emerges from the cell surface. The mature primary cilium consists of the basal body, which is anchored to the plasma membrane via distal appendages and to the microtubule network via subdistal appendages (SDA), and the axoneme, extending from the basal body. The ciliary pocket (CP) is formed via invagination of the membrane. 1.1.2. Actin during ciliogenesis Although the primary cilium is a predominantly microtubule-based structure, recent research indicates a prominent role for F-actin and actin-associated proteins in ciliary development and maintenance. Actin structures are important for various aspects of cell homeostasis such as division, proliferation and migration. These structures include focal adhesions, stress fibres, lamellipodia, and filopodia (Fig. 2 A). Focal adhesions are required to anker the cell onto the substrate via actin regulators such as vinculin and paxillin (Humphries et al., 2007). They are further connected to stress fibres assembled by RhoA, containing anti-parallel F-actin bundles and extending all over the cell to form a stable actin network (Ridley and Hall, 1992). Within lamellipodia, found at the leading edge of the cell, a dynamic branched F-actin network is formed via the Arp2/3 actin nucleators and Rho GTPases, that cyclically builds up and collapses, moving the cell forward (Lai et al., 2008; Schaks et al., 2021). Microspikes called 3 Introduction filopodia are formed within lamellipodia. These structures move beyond the edge of lamellipodia to sense and seek out the surrounding environment. Instead of branched actin networks, filopodia contain a parallelized structure of dynamic F-actin filaments bundled via the actin regulator Fascin-1 (Pfisterer et al., 2020). Fig. 2: The actin cytoskeleton. A The main structures of the actin cytoskeleton include stress fibres that are terminated within focal adhesions, the lamella at the leading edge, which makes up the lamellipodium, and microspikes called filopodia that sense the surrounding environment. Filopodia contain parallelised F-actin structures, whereas the contractile stress fibres are made of anti-parallel fibres. The lamella is made of dense, branched actin networks. Besides these prominent structures, actin mesh is found throughout the whole cell body. Modified after (Letort et al., 2015). B Actin is found at the basal body, inside the ciliary axoneme and at the ciliary tip, where it is thought to facilitate the ectocytosis of vesicles as a way to disassemble primary cilia. There is lots of evidence for a functional role of numerous actin proteins during early ciliary development. A stable actin network including actin motor proteins is required for transport of preciliary vesicles to the basal body (Hong et al., 2015; Wu et al., 2018). During preciliary vesicle transport and docking, the microtubule and actin crosslinking factor MACF1 is further required, emphasising the importance of both stable actin and microtubule networks during the initiation of ciliogenesis (May-Simera et al., 2016). Centrosome positioning and docking is also dependent on interactions between cilia proteins and the actin scaffolding protein Nesprin-2 that activates the RhoA-dependent apical actin network at the basal body (Dawe et al., 2009; Pan et al., 2007). At the basal body, the actin nucleators Cobl, Arp2/3 and its activator Wash, a member of the Wiskott Aldrich Syndrome protein and scar homologue complex family, are 4 Introduction recruited to induce actin filament nucleation, which is critical for centrosome positioning (Farina et al., 2016; Haag et al., 2018; Obino et al., 2016). The basal body is further connected to the actin network via focal adhesion proteins such as focal adhesion kinase (FAK), paxillin and vinculin (Antoniades et al., 2014). Thus, the basal body was suggested to be both a microtubule- and actin-organising centre (Farina et al., 2016). The subsequent formation of the ciliary pocket requires membrane tubulation which also involves the actin cytoskeleton (Saito et al., 2017). Besides its role during early ciliogenesis, F-actin and actin regulators are involved in various aspects of cilia maintenance and disassembly. Despite the fact that the presence of F-actin is likely to be cell cycle and cell type-specific, F-actin was identified at the basal body (Farina et al., 2016; Molla-Herman et al., 2010; Saito et al., 2017), and in mature primary cilia inside the axoneme (Copeland et al., 2018; Kiesel et al., 2020; Lee et al., 2018; Phua et al., 2017) and even at the ciliary tip (Fig. 2B; Corral-serrano et al., 2020; Nager et al., 2017; Phua et al., 2017; Wang et al., 2019). Although the function of F-actin inside primary cilia is still not completely solved, it is thought to assist in the ectocytosis of ciliary vesicles as a way of ciliary disassembly (Corral-serrano et al., 2020; Nager et al., 2017; Phua et al., 2017; Spencer et al., 2019; Wang et al., 2019). Concomitantly, depolymerisation of F-actin was found to stabilise primary cilia (Bershteyn et al., 2010; J. Kim et al., 2010; Kim et al., 2015; Liang et al., 2016; Pitaval et al., 2010). Taken together, the assembly, maintenance and disassembly of primary cilia requires both the microtubule and actin networks. Disturbance of these complex mechanisms affect cilia development and function. Since the correct function of primary cilia is crucial for tissue development and homeostasis, ciliary defects can cause a range of severe genetic disorders, collectively termed ciliopathies. 5 Introduction 1.2. Ciliopathies Ciliopathies arise due to defective cilia development, function or disassembly and comprise both organ-specific disorders and pleiotropic syndromes where several organs are affected. The total prevalence of ciliopathies in the population ranges from 1:700 to 1:2000 (Wheway et al., 2019). Prominent examples for syndromic ciliopathies are Meckel-Gruber syndrome, Joubert syndrome, Alström syndrome, McKusick-Kaufman syndrome and Bardet-Biedl syndrome, often showing symptomatic overlaps in terms of their phenotype. Since primary cilia can be found on almost all human cell types, the phenotypes associated with ciliopathies are wide- ranging and diverse. They include retinopathies, renal impairment, obesity, polydactyly, brain and skeletal abnormalities, mental retardation, and situs inversus (Chen et al., 2021; Hildebrandt et al., 2011; McConnachie et al., 2021). Besides these most commonly occurring primary symptoms, secondary features such as cardiovascular defects, respiratory abnormalities, hearing loss, genital impairments, and defects of the endocrine system can also arise (Focșa et al., 2021). Table 1: Selected ciliopathies and overlapping syndromic features. BBS MKS JBTS JATD OFD1 MKKS SLS NPHP LCA ALMS Retinopathy ✔ ✔ ✔ ✔ ✔ ✔ ✔ ✔ Obesity ✔ ✔ Polydactyly ✔ ✔ ✔ ✔ ✔ ✔ Kidney ✔ ✔ ✔ ✔ ✔ ✔ ✔ disease Situs ✔ ✔ ✔ ✔ ✔ inversus Cognitive ✔ ✔ ✔ ✔ ✔ ✔ ✔ impairment BBS: Bardet-Biedl syndrome; MKS: Meckel-Gruber syndrome; JBTS: Joubert syndrome; JATD: Jeune syndrome; OFD1: Oro-facial-digital syndrome type 1; MKKS: McKusick-Kaufman syndrome; SLS: Senior-Loken syndrome; NPHP: Nephronophthisis; LCA: Leber congenital amaurosis; ALMS: Alström syndrome 6 Introduction 1.2.1. The Bardet-Biedl syndrome Bardet-Biedl syndrome (BBS), one of the first ciliopathies to be described as early as 1866 and 1933 (Clay, 1933), is predominantly inherited in an autosomal recessive manner and characterised by high genetic heterogeneity. However, due to the absence of a genotype-to- phenotype-correlation, the clinical expressivity is highly variable and pleiotropic (Badano et al., 2006; Katsanis, 2004). As a flagship ciliopathy, the Bardet-Biedl syndrome combines many primary features such as rod-cone dystrophy, obesity, polydactyly, hypogonadism, kidney abnormalities and cognitive impairment (Beales et al., 1999; Florea et al., 2021; Forsythe and Beales, 2013). 1.2.1.1. BBS protein functions Causative for the development of Bardet-Biedl syndrome are mutations in the BBS genes, encoding BBS proteins that execute critical ciliary functions. So far, 24 different BBS-related proteins have been identified that are listed below (Table 2; Florea et al., 2021). Some of these proteins are organised in complexes, such as the BBSome or the chaperonin-like complex which will be described in more detail below. Other BBS proteins such as BBS15-17 are involved in signalling pathways or in case of BBS19-20 the intraflagellar trafficking inside the cilium. Table 2: BBS proteins, related functions and cellular localisation. Adapted from Florea et al., 2021. BBS Symbol Protein Name Function/Family Localisation 1 BBS1 Bardet–Biedl BBSome Basal body, cilium syndrome protein 1 2 BBS2 Bardet–Biedl BBSome Basal body, cilium syndrome protein 2 3 BBS3/ARL6 ADP-ribosylation ARF GTPase family Basal body, cilium, factor-like protein 6 BBSome recruitment cytosol, transition zone 4 BBS4 Bardet–Biedl BBSome Basal body, cilium syndrome protein 4 5 BBS5 Bardet–Biedl BBSome Basal body syndrome protein 5 7 Introduction 6 BBS6/MKKS McKusick–Kaufman Chaperonin-like Basal body, cytosol syndrome protein 7 BBS7 Bardet–Biedl BBSome Basal body, cilium syndrome protein 7 8 BBS8/TTC8 Tetratricopeptide BBSome Basal body, cilium, repeat domain protein IFT 8 9 BBS9 Bardet–Biedl BBSome Cilium syndrome protein 9 10 BBS10 Bardet–Biedl Chaperonin-like Basal body syndrome protein 10 11 TRIM32 Tripartite motif E3 ubiquitin-protein Intermediate filaments containing 32 ligase 12 BBS12 Bardet–Biedl Chaperonin-like Basal body syndrome protein 12 13 MKS1 Meckel syndrome type B9 domain containing Basal body 1 protein MKS complex 14 CEP290 Centrosomal protein of MKS complex Basal body, 290 kDa centrosome 15 WDPCP WD repeat containing Ciliogenesis and planar Cytosol, plasma planar cell polarity polarity effector membrane, axoneme effector protein complex 16 SDCCAG8 Serologically defined MicroRNA protein Basal body, centriole, colon cancer antigen 8 coding, Shh signalling transition zone 17 LZTFL1 Leucine zipper BBSome antagonist, Basal body, cilium transcription factor-like Wnt/Shh signalling protein 1 18 BBIP1 BBSome-interacting BBSome Cytoplasm, cytosol protein 1 19 IFT27 Intraflagellar transport IFT complex Basal body, cilium, protein 27 IFT 20 IFT74 Intraflagellar transport IFT complex Basal body, cilium, protein 74 IFT 21 C8orf37 Chromosome 8 open Basal body, ciliary root reading frame 37 protein 8 Introduction 22 SCLT1 Sodium channel and Centriole clathrin linker 1 23 NPHP1 Nephrocystin-1 NPHP complex Transition zone 24 SCAPER S-phase cyclin A Zinc finger ER associated protein in the ER ARF: ADP-ribosylation factor; BBS: Bardet-Biedl syndrome; ER: Endoplasmic reticulum; IFT: Intraflagellar transport, MKKS: McKusick–Kaufman syndrome; MKS: Meckel syndrome; NPHP: Nephrocystins; Shh: Sonic hedgehog The eight proteins BBS1, BBS2, BBS4, BBS5, BBS7, BBS8, BBS9 and BBS18/BBIP1 are found in a complex, called the BBSome, that acts as an adaptor for proteins of the intraflagellar transport machinery, enabling cargo of proteins and vesicles into (anterograde) and out of (retrograde) the primary cilium (Blacque et al., 2004; Lechtreck et al., 2009; Nachury et al., 2007; Ye et al., 2018). In cooperation with the small Arf-like GTPase ARL6/BBS3 in its GTP- bound active state, the BBSome is recruited to cilia and regulates import and export of proteins into and out of the cilium (Fig. 3; Jin et al., 2010; Liew et al., 2014; Singh et al., 2020; Xue et al., 2020). The assembly of the BBSome is facilitated by the BBS/CCT chaperonin complex consisting of the chaperonin-like BBS proteins BBS6, BBS10 and BBS12 and members of the CCT/TriC (Chaperonin containing TCP-1/T-complex protein-1 ring complex) family of chaperonins. The chaperonin-like BBS proteins BBS6, BBS10 and BBS12 share sequence homology with the chaperonin containing t-complex protein 1 of the CCT family of group II chaperonins (Kim et al., 2005; Stoetzel et al., 2007, 2006). Under hydrolysis of ATP, the CCT chaperonins are known to mediate the folding of cytoskeleton-associated proteins such as actin and tubulin and the assembly of the BBSome (Dunn et al., 2001; Sinha et al., 2014). 9 Introduction Fig. 3: BBSome assembly and IFT transport. The BBSome (BBS1, 2, 4, 5, 7, 8, 9, 18) is assembled via a complex consisting of the chaperonin-like proteins BBS6, BBS10, BBS12 and CCT chaperonins. BBS2, BBS7 and BBS9 make up the BBSome core complex, whereas BBS4 is the last component to join (Chou et al., 2019). As soon as the BBSome is assembled, it is recruited to the cilium via ARL6/BBS3. The BBSome acts as an adaptor for IFT trains and regulates entry and export of proteins and signalling receptors required for cilia function. ARL6: ADP-ribosylation factor-like protein 6; BB: Basal body; CCT: Chaperonin containing TCP-1; IFT: Intraflagellar transport. Since they share sequence homology with the CCT chaperonins, the protein structure of the three BBS proteins is simple but mostly evolutionary conserved, comprising of one apical domain that is flanked by intermediate and equatorial domains (Álvarez-Satta et al., 2017). The ATP hydrolysis motif in the equatorial domain is conserved in BBS10, but altered in both BBS6 and BBS12, which is why they are not thought to exert a folding function. Furthermore, due to several amino acid insertions, all BBS chaperonin-like proteins are not thought to be able to build a functional oligomeric complex like CCT chaperonins do (Kim et al., 2005; Mukherjee et al., 2010; Stoetzel et al., 2007, 2006). However, they play an important role in the assembly of the BBSome (Fig. 3). As a first step, BBS6 and BBS12 bind to and stabilise BBS7 and, in cooperation with BBS10, mediate its interaction with the CCT chaperonin complex (Seo et al., 2010; Zhang et al., 2012). The CCT complex, consisting of the CCT proteins CCT1-5 and 10 Introduction CCT8, further executes the folding of BBS7 (Sinha et al., 2014; Zhang et al., 2012). After release of BBS6 and BBS12 from the chaperonin-complex, BBS2 binds to BBS7, followed by BBS9, together generating the BBSome core complex. Subsequently, the CCT chaperonins are also liberated from the complex (Zhang et al., 2012). Due to intrinsic protein-protein- interactions, the remaining BBSome components join the complex, enabling its final recruitment to the primary cilium and its function in cargo trafficking. Structurally, BBS2 and BBS7 form the top portion of the BBSome, while BBS5, BBS8 and BBS9 form the base (Chou et al., 2019). BBS4 is the last BBSome component to be added as it moves from centriolar satellites to the BBSome shortly before cilia entry (Fig. 3; Chou et al., 2019; Loktev et al., 2008; Zhang et al., 2012). Up to 50% of all diagnosed BBS patients carry pathogenic variants of the three chaperonin-like genes (Billingsley et al., 2010; Deveault et al., 2011; Muller et al., 2010). To be more precise, BBS1 and BBS10 are the most frequent mutated genes in individuals diagnosed with BBS, accounting together for more than 50% of the cases, followed by BBS12 with 10% (Forsythe et al., 2015; Forsythe and Beales, 2013; Muller et al., 2010). It was also suggested that patients with mutations in the chaperonin-like BBS genes develop a more severe phenotype, including earlier onset of disease, higher prevalence of primary symptoms and more overlap with other ciliopathies such as Alström or McKusick-Kaufman syndrome (Billingsley et al., 2010; Castro- Sánchez et al., 2015; Imhoff et al., 2011). However, some mutations in the BBS genes, especially for recent identified genes such as BBS21-BBS24, were only identified in few individuals, where clinical features were crucial to identify them as BBS genes (Heon et al., 2016; Morisada et al., 2020; Wormser et al., 2019). 1.2.1.2. Actin-related BBS protein functions Besides their well-described function in ciliogenesis, some ciliary proteins were found to affect various other aspects of cell homeostasis, such as cell cycle, transcriptional splicing, cytoskeleton organisation or cell migration (Lin et al., 2018; Wood et al., 2012; Yin et al., 2009). In particular BBS proteins have been highlighted in non-cilia related functions, such as intracellular trafficking (Leitch et al., 2014; May-Simera et al., 2015; Yen et al., 2006), cell cycle regulation (Delaval et al., 2011; Wood et al., 2012), proteasomal degradation (Gerdes et al., 2007; Kudryashova et al., 2005; Liu et al., 2014), DNA damage response (O’Regan et al., 2007), and transcriptional regulation (Gascue et al., 2012). Especially the regulation of BBS 11 Introduction proteins in actin networks is well documented (Gerdes et al., 2007; Hernandez-Hernandez et al., 2013; May-Simera, 2016; May-Simera et al., 2010; Ross et al., 2005; Tobin et al., 2008). More specifically, the BBSome components Bbs4 and Bbs8 were shown to be required for cell migration and division since they are involved in the regulation of filopodia and development of lamellipodia (Hernandez-Hernandez et al., 2013; Tobin et al., 2008). This was mainly due to organisation of the apical actin network and actin stress fibre polymerisation (Hernandez- Hernandez et al., 2013; May-Simera et al., 2010). In addition to their ciliary localisation, the BBSome proteins BBS8 and BBS9 were further found to localise to focal adhesions, suggesting a role of these proteins in the regulation of actin structures (Hernandez-Hernandez et al., 2013). Concordantly, Bbs4 and Bbs8 are thought to prevent focal adhesion formation by inhibiting actin polymerisation via regulation of RhoA signalling (Hernandez-Hernandez et al., 2013). Although BBS6 is not a component of the BBSome, but involved in its assembly via interaction with CCT chaperonins, a similar role for Bbs6 in the RhoA-dependent regulation of actin stress fibres has been postulated (Hernandez-Hernandez et al., 2013). Besides regulation of RhoA, BBS6 has been also shown to regulate the downstream actin and microtubule networks via interaction with the microtubule and actin crosslinking factor 1 (MACF1) (May-Simera et al., 2016, 2009). The regulation of the ciliary BBS proteins in actin networks can be ascribed to their involvement in ciliary signalling which will be described below. Since Wnt signalling is one of the main ciliary signalling pathways that directly targets the downstream actin network, it is of particular interest in the present work. 12 Introduction 1.3. Wnt signalling Primary cilia are implicated in the regulation of several signalling pathways, such as Sonic hedgehog (Shh), platelet-derived growth factor (PDGF) or Wnt signalling (Bangs and Anderson, 2017; Lee, 2020; Umberger and Caspary, 2015). The Wnt signalling pathway is one of the main cilia-regulated pathways affecting downstream actin perturbations (Balmer et al., 2015; Corbit et al., 2008; Cui et al., 2013; Gerdes et al., 2007; May-Simera et al., 2015, 2010; McMurray et al., 2013; Wang et al., 2017). Fig. 4: The Wnt signalling pathway. Graphical representation of canonical and non-canonical (PCP) Wnt signalling. During canonical Wnt signalling, the WNT ligand binds to a co-receptor complex consisting of LRP5/6 (low‐density lipoprotein receptor‐related proteins 5/6) and Frizzled (FZD). This results in activation of Dishevelled (DVL), which binds to and inactivates the β-catenin degradation complex consisting of APC (adenomatous polyposis coli), Axin, GSK3β (glycogensynthase kinase 3β) and CK1 (Casein kinase 1). β-catenin (β-cat) accumulates and enters the nucleus, where it activates the transcription of Wnt target genes such as Cyclin D1 or Myc. During PCP (planar cell polarity) signalling, binding of the WNT ligand results in the translocation of Dishevelled via Inversin, subsequently activating downstream signalling cascades involving RAC, DAAM1 (Dishevelled-associated activator of morphogenesis 1) and RHOA (Ras homolog family member A), leading to actin rearrangements. A slight variation of this figure is also included in Manuscript I. TCF: T-cell factor, LEF: lymphoid enhancer‐binding factor, ROCK: Rho-associated, coiled-coil-containing protein kinase, JNK: c-Jun N-terminal kinase, JUN: c-Jun PM: plasma membrane, P: phosphorylation. 13 Introduction Wnt signalling is composed of two main branches: canonical or β-catenin dependent Wnt signalling and non-canonical Wnt, comprising the planar cell polarity (PCP) and Calcium dependent Wnt signalling pathways. Canonical Wnt signalling is controlled via precise regulation of cytosolic β-catenin levels (Fig. 4). During canonical Wnt, a coreceptor complex, the so-called signalosome, consisting of the G-protein coupled receptor Frizzled (FZD) and the low‐density lipoprotein receptor‐related proteins 5/6 (LRP5/6), is activated via binding of a WNT ligand (Bilić et al., 2007; Cong et al., 2004). WNT ligands can activate both canonical (β-catenin dependent) or non-canonical Wnt. Some of 19 total WNT ligands can preferentially affect one pathway, such as WNT3a which activates the canonical branch (Willert et al., 2003; Xu and Gotlieb, 2013) and WNT5a activating PCP signalling (Kikuchi et al., 2007). However, the specificity of WNT ligands in general is not completely set in stone, but rather receptor and cell-type specific (Kyun et al., 2020; Okamoto et al., 2014). Besides WNT ligands, other molecules can also target LRP receptors such as the Wnt antagonists Dickkopf-related protein 1 (DKK1) (Semënov et al., 2008, 2001), secreted Frizzled-related protein 1 (SFRP1), Wnt inhibitory factor (WIF), Sclerostin, and the Wnt agonists R-spondin and Norrin (Cruciat and Niehrs, 2013). Binding of the Wnt ligand to the LRP5/6 signalosome results in the recruitment of Dishevelled (DVL), casein kinase 1 α (CK1α), glycogensynthase kinase 3β (GSK3β) and Axin to the receptor complex (Cong et al., 2004; Davidson et al., 2005; Krasnow et al., 1995), which leads to disassembly of the so-called β-catenin destruction complex (Cselenyi et al., 2008; Piao et al., 2008; Stamos et al., 2014). This complex, which is required for phosphorylation of β-catenin in the absence of WNT ligands, consists of Axin, adenomatous polyposis coli (APC), GSK3β and CK1α (Kishida et al., 1998; Rubinfeld et al., 1996). Due to its inhibition, unphosphorylated, active β-catenin can accumulate in the cytoplasm and is shuttled to the nucleus where it acts as a coactivator of the transcription factors T-cell factor/lymphoid enhancer‐binding factor (TCF/LEF) which initiate the transcription of Wnt target genes in a context-dependent manner (Behrens et al., 1996; Molenaar et al., 1996; Van de Wetering et al., 1997). This process is initiated by β-catenin detaching the co‐repressor Groucho/transducin‐like enhancer of split from TCF/LEF (Cavallo et al., 1998; Flack et al., 2017; Roose et al., 1998). Besides TCF/LEF, β-catenin was shown to bind to and recruit several coactivators such as B‐cell lymphoma 9 (BCL9), BCL9‐like (BCL9L), Pygopus (Pygo 1 or Pygo 2), or CREB‐binding protein (CBP)/p300 in a context-dependent fashion (Hoffmans and Basler, 2007; Sustmann et al., 14 Introduction 2008). Subsequently, the activation of canonical Wnt signalling results in cell proliferation and differentiation. During the planar cell polarity pathway (PCP), a non-canonical Wnt signalling branch, the Frizzled receptor is also activated via WNT ligands (Minegishi et al., 2017). This results in the recruitment of Dishevelled to the plasma membrane via the ciliary protein Inversin, where it interacts with actin regulators such as the small GTPase RAC1 or the formin DAAM1 (Habas et al., 2001; Simons et al., 2005). Consequently, signalling cascades are activated via actin regulators RhoA, ROCK and JNK, that lead to the transcription of cytoskeletal genes such as JUN, subsequently affecting subapical actin rearrangements (Habas et al., 2001; Liu et al., 2008). During PCP signalling, β-catenin is phosphorylated via the destruction complex (Fig. 4). APC and Axin facilitate the CK1α dependent phosphorylation of β-catenin at residue Ser45 which then enables the phosphorylation via GSK3β at Ser33, Ser37 and Thr41 (Amit et al., 2002; Ikeda et al., 1998; Liu et al., 2002; Wu and He, 2006). Phosphorylated β-catenin is recognised by the Skp1-Cullin1-F-box (SCF) E3 ubiquitin ligase complex, which ubiquitinates β-catenin and induces its proteasomal degradation (Hart et al., 1999; Yanagawa et al., 2002; Yost et al., 1996). Besides being phosphorylated, β-catenin can also be acetylated at Lys49 via CBP regulating its transcriptional activity in a promoter specific fashion (Wolf et al., 2002). Since PCP signalling results in changes of the actin cytoskeleton, leading to the coordinated orientation of cells within a tissue, it is highly crucial for organ development (Gong et al., 2004; Luo et al., 2020). 1.3.1. Ciliary regulation of Wnt signalling The balance between the Wnt signalling branches is highly crucial for cell homeostasis and during tissue development (Gong et al., 2004; Luo et al., 2020). In various tissues such as the retina or cochlea, disturbance of Wnt signalling was shown to result in defective tissue development leading to blindness or hearing loss (Kretschmer and May-Simera, 2020; Munnamalai and Fekete, 2013). Primary cilia regulate the switch between canonical and non- canonical Wnt signalling via the ciliary protein Inversin. In ciliated cells, Inversin is found at the basal body and transition zone of primary cilia, where it inhibits canonical Wnt during ciliogenesis, thus ciliary development occurs during non-canonical Wnt (Lienkamp et al., 2012; Simons et al., 2005). Concordantly, β-catenin was found to be recruited to mature primary cilia, 15 Introduction preventing its nuclear activity (Ajima and Hamada, 2011). Furthermore, loss of proteins required for cilia development leads to hyperactivation of canonical Wnt (Ajima and Hamada, 2011; Corbit et al., 2008; Gerdes et al., 2007). As bona-fide cilia proteins, BBS proteins were also found to directly influence ciliary Wnt signalling, consequently regulating downstream actin networks. 1.3.2. BBS proteins in Wnt signalling In vivo data from various animal models suggest that the BBS proteins BBS4, BBS6 and BBS8 might be involved in non-canonical Wnt (PCP) signalling, subsequently affecting actin networks (Gerdes et al., 2007; May-Simera et al., 2010; Ross et al., 2005; Tobin et al., 2008). In zebrafish, knockout of bbs6 and bbs8 resulted in enhanced canonical Wnt signalling which consequently disrupts curvature of the body axis, a common readout for defective PCP (Gerdes et al., 2007; May-Simera et al., 2015, 2010). In mice, Bbs4 and Bbs6 were found to affect the polarisation of stereocilia hair bundles in the cochlea, another downstream effect of PCP signalling (Ross et al., 2005). Concordantly, BBS8 has been shown to interact with Inversin, key regulator of the switch between the Wnt branches (May-Simera et al., 2018), and with Vangl2, prominent PCP effector (May-Simera et al., 2015, 2010). Another example of BBS proteins being involved in the regulation of actin networks via PCP signalling is BBS15, also referred to as WDPCP, which is a well-known effector of non-canonical Wnt signalling (S. K. Kim et al., 2010). BBS15 further localises to and modulates actin stress fibres via interaction with the transition zone protein septin 2, subsequently enabling cell polarity, focal adhesion formation and cell motility (Cui et al., 2013). Taken together, these data show that the ciliary BBS proteins are involved in the regulation of Wnt signalling pathways, which consequently affects the downstream actin network. However, the precise regulations remain to be elucidated. 16 Introduction 1.4. Objectives To better understand of the molecular background underlying human ciliopathies, it is essential to know the exact function of ciliary proteins. This is not only important for understanding the disease and its complex phenotypic features but also to provide background for the development of potential therapeutics. In order to expand our knowledge of the function of ciliary proteins, this work aims to identify both ciliary and non-ciliary functions of the bona-fide BBS proteins. Bardet-Biedl syndrome as a model will help to approach this objective since BBS combines many clinical features, providing background to understand the molecular mechanisms of other ciliopathies as well. To reach this aim, three different yet overlapping objectives are formulated here: the expression levels of Bbs genes in different tissues will be first analysed to infer potential tissue-dependent functions of BBS proteins. Dependent on previous studies, the function of BBS proteins in Wnt signalling during tissue development will be examined. Subsequently, the downstream evaluation of ciliary proteins in actin dynamics and the role of actin proteins in ciliogenesis is of further interest to provide a broader background to contextualise the interplay between ciliogenesis, Wnt signalling and actin networks. Objective 1: Investigation of potential tissue-dependent regulations of BBS proteins. Since the ciliopathy Bardet-Biedl syndrome exhibits diverse phenotypes affecting many different organs of the human body, the first objective of the current work was to identify differences in gene expression of Bbs genes in different mouse tissues. The phenotypic occurrence of Bardet-Biedl syndrome is quite variable between patients, affecting various organs such as the retina, kidney, or gonads (Beales et al., 1999; Florea et al., 2021; Forsythe and Beales, 2013). This raises the possibility for tissue-dependent functions of BBS proteins and also potential non-cilia related functions. Thus, Publication I aims to get a better understanding of BBS protein functions within different tissues via analysis of comparative regulation of gene expressions. 17 Introduction Objective 2: Analysis of BBS functions in cilia-related Wnt signalling during RPE development. The second objective aims to identify the role of BBS proteins during development of the retinal pigment epithelium (RPE), a ciliated monolayer in the eye crucial for visual function. Since BBS proteins were shown to be involved in Wnt signalling (Gerdes et al., 2007; May-Simera, 2016; May-Simera et al., 2015, 2010; Ross et al., 2005), the role of BBS proteins during this pathway in relation to ciliary disassembly was investigated in more detail in Publication II. Since Wnt signalling is a major pathway required for RPE development, this improves the understanding of the molecular pathways underlying the visual phenotype occurring in Bardet- Biedl syndrome and further elucidates the role for BBS proteins in Wnt signalling and its downstream effects. Objective 3: Investigation into the connection between BBS, Wnt signalling and the downstream actin network. Since BBS proteins are involved in Wnt signalling, which is tightly linked with a coordination of the downstream actin networks (Hernandez-Hernandez et al., 2013; Tobin et al., 2008), the interplay between BBS proteins and the actin network was investigated in Manuscript I. On the other hand, the actin network also plays an important role during ciliogenesis (Bershteyn et al., 2010; J. Kim et al., 2010; Kim et al., 2015; Liang et al., 2016; Pitaval et al., 2010), indicating potential feedback mechanisms between actin and cilia phenotypes. Thus, the complex regulations between actin and primary cilia were enlightened by reviewing the current literature in Publication III. 18 Publications & Manuscripts 2. Publications and Manuscripts Publication I Patnaik SR, Farag A, Volz AK, Brücker L, Schneider S, Kretschmer V, May-Simera HL (2020): Tissue dependent differences in Bardet-Biedl Syndrome gene expression. Biol Cell; 112(2):39-52 Publication II Patnaik SR, Kretschmer V, Brücker L, Schneider S, Volz AK, Oancea-Castillo LDR, May- Simera HL (2019): Bardet-Biedl Syndrome proteins regulate cilia disassembly during tissue maturation. Cell Mol Life Sci; 76(4):757-775 Manuscript I Brücker L, Becker SK, Harms G, Parsons M, May-Simera HL: The actin-bundling protein Fascin-1 modulates ciliary signalling. Submitted at JMCB Feb 2022, in revision. Publication III Brücker L, Kretschmer V, May-Simera HL (2020): The entangled relationship between cilia and actin. Review. IJBCB; 129: 105877 19 Publications & Manuscripts Publication I 20 Biol. Cell (2020) 112, 39–52 DOI: 10.1111/boc.201900077 Research article Tissue-dependent differences in Bardet–Biedl syndrome gene expression Sarita Rani Patnaik, Aalaa Farag, Lena Brücker, Ann-Kathrin Volz, Sandra Schneider, Viola Kretschmer and Helen Louise May-Simera1 Cilia Cell Biology, Institute of Molecular Physiology, Johannes-Gutenberg University, Mainz 55128, Germany Background Information. Primary cilia are highly conserved multifunctional cell organelles that extend from the cell membrane. A range of genetic disorders, collectively termed ciliopathies, is attributed to primary cilia dysfunction. The archetypical ciliopathy is the Bardet–Biedl syndrome (BBS), patients of which display virtually all symptoms associated with dysfunctional cilia. The primary cilium acts as a sensory organelle transmitting intra- and extra- cellular signals thereby transducing various signalling pathways facilitated by the BBS proteins. Growing evidence suggests that cilia proteins also have alternative functions in ciliary independent mechanisms, which might be contributing to disease etiology. Results. In an attempt to gain more insight into possible differences in organ specific roles, we examined whether relative gene expression for individual Bbs genes was constant across different tissues in mouse, in order to distin- guish possible differences in organ specific roles. All tested tissues show differentially expressed Bbs transcripts with some tissues showing a more similar stoichiometric composition of transcripts than others do. However, loss of Bbs6 or Bbs8 affects expression of other Bbs transcripts in a tissue-dependent way. Conclusions and Significance. Our data support the hypothesis that in some organs, BBS proteins not only function in a complex but might also have alternative functions in a ciliary independent context. This significantly alters our understanding of disease pathogenesis and development of possible treatment strategies.  Additional supporting information may be found online in the Supporting Information section atthe end of the article. Introduction which are found on specialised tissues, primary cilia Primary cilia are highly conserved multifunctional are a component of virtually all vertebrate cells, cell organelles that extend from the cell membrane. and functional defects cause a wide spectrum of These microtubule-based appendages are vital for de- clinical phenotypes. A range of genetic disorders, velopment and homeostasis of different organs and collectively termed ciliopathies, is attributed to pri- tissues and play a role in transduction of intra- mary cilia dysfunction. The archetypical ciliopathy and extracellular signals. In contrast to motile cilia, is the Bardet–Biedl syndrome (BBS), patients of which display retinopathy, kidney dysfunction, obe- 1To whom Correspondence should be addressed (email sity, polydactyly, behavioural dysfunction and hypog- hmaysime@uni-mainz.de) Key words: bardet-biedl syndrome, cilia, ciliopathy, gene regulation, mRNA. onadism [Forsythe and Beales, 2013]. Abbreviations: Arl6, ADP-ribosylation factor-like protein 6; ARVO, Associa- The primary cilium acts as a sensory organelle tion for Research in Vision and Ophthalmology; BBS, Bardet–Biedl syndrome; CCT/TRiC, chaperonin-containing TCP1 complex; cDNA, complementary de- transmitting intra- and extracellular signals oxyribonucleic acid; DNA, deoxyribonucleic acid; DEPC, diethyl pyrocarbonate; [Ishikawa and Marshall, 2011] thereby transducing GPCR, G protein-coupled receptor; Gapdh, glyceraldehyde 3-phosphate dehy- drogenase; IFT, intraflagellar transport; Mkks, McKusick-Kaufman syndrome; mRNAs, messenger ribonucleic acids; OD, optical density; PCR, polymerase This is an open access article under the terms of the Creative Commons chain reaction; qRT-PCR, quantitative real-time polymerase chain reaction; Attribution-NonCommercial-NoDerivs License, which permits use and distribu- RNA, ribonucleic acids; RNF2, RING finger protein 2; TOR, target of rapamycin; tion in any medium, provided the original work is properly cited, the use is UK, United Kingdom; Usf1, upstream stimulatory factor 1. non-commercial and no modifications or adaptations are made. ©C 2019 The Authors. Biology of the Cell published by Wiley-VCH Verlag GmbH & Co. KGaA on behalf of Société Française des Microscopies and Société de 39 Biologie Cellulaire de France S. R. Patnaik and others various signalling pathways including Wnt [May- retina. Because alternative splicing can produce tran- Simera and Kelley, 2012], Hedgehog [Goetz and scripts with different stabilities, we designed primers Anderson, 2010], Notch [Ezratty et al., 2011], to recognise as many of the different Bbs transcripts PDGF [Schneider et al., 2005], TOR [Yuan et al., as possible (Table 1). An important consideration is 2013] and Hippo [Habbig et al., 2011]. Correct sig- that expression levels of housekeeping genes can vary nal transduction is essential for tissue development across tissues, therefore caution must be used when and homeostasis and the Bardet–Biedl syndrome comparing gene expression levels across multiple tis- proteins have been shown to play a crucial role in sues and normalizing to expression of a single house- this. To date, 23 BBS genes (BBS1 - 23) have been keeping gene. We chose Gapdh as a housekeeping reported. Most recently two BBS disease causing control gene since the expression of Gapdh was more loci have been found in other cilia associated genes, stable across the tissues examined than Usf1 or other namely IFT74/BBS22 and SCAPER/BBS23 [Lind- cytoskeletal markers (Supporting Information Figure strand et al., 2016; Schaefer et al., 2019; Wormser 1). Furthermore we saw no differences in levels of et al., 2019]. A subset of these genes encodes proteins Gapdh expression between either of our mutants and that form an octameric complex termed the BBSome, their littermate controls. which is crucial for ciliary trafficking [Jin et al., Our results show that Bbs transcripts are differen- 2010]. The assembly of this complex is facilitated by tially expressed in different tissues when normalised chaperonin-like BBS proteins [BBS6/MKKS, BBS10 against the housekeeping control Gapdh (Figure 1a– and BBS12; Seo et al., 2010; Zhang et al., 2012]. h). The expression levels of most BBSome transcripts Although a defect in any BBS gene gives rise to a were highest in the retina with the exception ofBbs18 BBS diagnosis, there is a huge degree of phenotypic (Figure 1h). This correlates with the functional role variation with no clear genotype to phenotype of the BBSome in trafficking across the connecting correlation even within families. cilium in photoreceptors [Datta et al., 2015]. Al- Growing evidence suggests that cilia proteins also though the BBSome has a trafficking role in all cilia, have alternative functions in ciliary independent the volume of traffic required to build and maintain mechanisms. Such extraciliary functions include cell the photoreceptor outer segment is particularly high cycle regulation, non-ciliary trafficking, regulation and requires continuous turnover of ciliary traffick- of the DNA damage response, and transcriptional ing proteins. Expression of Bbs18 was most abundant control [Vertii et al., 2015; Hua and Ferland, 2018]. in the spleen and oviduct. In light of this, it is plausible that the BBSome and BBS chaperonin-like proteins also have alternative Expression of BBSome transcripts within a tissue functions, possibly in an individual protein depen- is not stoichiometric dent manner. In an attempt to gain more insight into Comparison of BBSome expression levels within a this, we examined whether relative gene expression specific tissue revealed variable BBSome composition for individual Bbs genes was constant across different across different tissues. Expression of BBSome tissues, in order to distinguish possible differences mRNAs were not stoichiometric, rather they were in organ specific roles. Furthermore, we wanted differentially expressed in specific tissues (Fig- to examine the effect of Bbs protein loss on other ure 2a–g). Interestingly, the expression profiles in BBSome or chaperonin-like components. brain and kidney were strikingly similar (Figures 2a and 2b). Bbs1 was the most abundantly expressed Results transcript in brain and kidney, yet one of the Differential expression of BBSome transcripts least abundant transcripts in heart and oviduct across mouse tissues (Figure 2a, 2b, 2e, and 2f). Bbs18 was most abundant To determine tissue specific expression levels of BB- in the spleen, heart and oviduct, yet contributed Some and chaperonin-likeBbs transcripts, we assessed the least in the retina (Figure 2g). Interestingly, their relative expression in a variety of adult mouse Bbs9 was highly abundant in the retina and spleen tissues. Quantitative real-time PCR (qRT-PCR) was (Figures 2d and 2g). However, mutations in the used to examine the abundance of mRNA transcripts BBS9 gene have been implicated in nonsyndromic in brain, kidney, lung, spleen, heart, oviduct and craniosynostosis [Barba et al., 2018]. These results 40 www.biolcell.net | Volume (112) | Pages 39–52 Tissue-dependent differences in Bardet–Biedl syndrome gene expression Research article Table 1 Gene symbol, primer sequences, primer efficiency for each evaluated Primer Gene symbol Primer sequencesForward n Reverse Primer efficiency Transcript identified Bbs1 CCCTACTTCAAGTTCAGCCTG 114.35% ENSMUST00000053506.7 TCTGCCTTTTCCCTGATGTC Bbs2 ACATTGCCCCACCTCTTG 115% ENSMUST00000034206.5 TCTTCCCATCACCGTCAAAG Bbs3 GATACCCTTCTGAATCACCCAG 107.23% ENSMUST00000023405.9 CCACGGCTTGTCTTTAATGC ENSMUST00000099646.3 ENSMUST00000118438.1 ENSMUST00000149797.1 Bbs4 GCTCCAGACTTCCCTATTGTG 109.34% ENSMUST00000026265.7 GCATATTCACATAGCCCCTGAG Bbs5 ACAAAGTCTATTCTGCCAGTCC 98.31% ENSMUST00000074963.8 AAATACGCCACAAAAGCATCC ENSMUST00000112286.8 ENSMUST00000134659.7 Bbs6 GTGTGCTCTGCAAGATTTGG 97.74% ENSMUST00000110089.8 AAGACGTGCATTGCTGTTTG ENSMUST00000028730.12 Bbs7 ATGGATCTGACGTTAAGCCG 112.60% ENSMUST00000108156.8 CCTTTTGTGTAGCCCTTTGTCTTGAGGT ENSMUST00000040148.10 ENSMUST00000108155.7 ENSMUST00000129671.1 Bbs8 GAGGCAGCTGATGTCTGGTACA 98.25% ENSMUST00000085109.9 CATTGGTGGGCCAAGTTTGT ENSMUST00000079146.12 Bbs9 ACAAATCTCCTGTCAGTCTGC 96.84% ENSMUST00000147712.7 TCGTTGGGATGTTCTGGAAG ENSMUST00000150395.7 ENSMUST00000039798.15 ENSMUST00000147405.7 ENSMUST00000127296.7 Bbs10 TCCAGCCTCAGTTTTCATCG 111.39% ENSMUST00000040454.4 ACTGAGATGCCTGAAACTGTG ENSMUST00000219990.1 Bbs12 CGCCGAGCATTGGATGTAG 104.30% ENSMUST00000057975.7 CATGCACACCCACACGT ENSMUST00000108121.3 Bbs18 CCCTTAAAATCTCTGACGCTGG 102.75% ENSMUST00000135402.3 TGCCTTTTCTGCCATTTCTTG ENSMUST00000236885.1 ENSMUST00000235348.1 ENSMUST00000236370.1 ENSMUST00000236098.1 ENSMUST00000235688.1 ENSMUST00000237049.1 Gapdh CGACTTCAACAGCAACTCCCACTCTTCC 99.58% ENSMUST00000118875.7 TGGGTGGTCCAGGGTTTCTTACTCCTT ENSMUST00000117757.8 ENSMUST00000073605.14 ENSMUST00000183272.1 suggested either tissue-dependent differences in With exception of lung and heart, which both had BBSome composition and/or protein half-life, or that slightly higher levels of expression; the level of Bbs6 some of these transcripts are required for alternative was relatively constant (Figure 3a). The expression non-BBSome-related functions in different tissues. pattern of Bbs10 was largely consistent across differ- ent tissues (Figure 3b). Bbs12 expression varied the Less variable expression of BBS chaperonin-like most, with lower expression in brain and kidney and transcripts across mouse tissues higher expression in the spleen, oviduct and retina Next, we determined the gene expression patterns of (Figure 3c). the three chaperonin-like Bbs transcripts (Bbs6/Mkks, When looking at these expression levels within Bbs10 and Bbs12; Figure 3). Overall, we saw less specific tissues, we observe a similar stoichiometry variation of these transcripts across different tissues. of expression in brain and kidney (Figure 3d,e), akin ©C 2019 The Authors. Biology of the Cell published by Wiley-VCH Verlag GmbH & Co. KGaA on behalf of Société Française des Microscopies and Société de 41 Biologie Cellulaire de France S. R. Patnaik and others Figure 1 Expression of BBSome transcripts Bar charts showing gene expression of Bbs1,2,4,5,7,8,9,18 in different tissues relative to Gapdh. Relative expression levels of each sample averaged. Error bars show standard error of the mean. n = 4 for all genes, Bbs8 n = 3. Statistics were done using the Dunnett’s multiple comparison test *p  0.05; **p  0.01; *p  0.001; ns, not significant. a 0.25 b 0.6 ns ** 0.5 0.20 ns 0.4 0.15 * *** *** ns 0.3 ns *** ns 0.10 ns ns 0.2 0.05 0.1 0.00 0.0 in ey ng en r t ct na in ey g en rt tn ara a i a a cdn u le e duL et r dn Lu l e e du et in B i p i K S H v R B i p i O K S H v R O c 0.4 d 0.4 ** *** 0.3 ns 0.3 **ns ns ns ns 0.2 ns ns 0.2 ns ns 0.1 0.1 0.0 0.0 n i y g n rt ct n y a e n e a i a u in a ne n g ee n rt ct na r dn eLu l e id et r u B id L pl a u ti B ei p id e K S H v R K S H v R O O e 0.6 f 0.4 * 0.5 *** 0.3 ns ns 0.4 ns 0.3 0.2 ns ns ns 0.2 ns ns ns ns 0.1 0.1 0.0 0.0 t n in y n t t aa e y ng en r t r a u c in a ra i e ng e ar c in B id n u leL tp eH id e B id n e u t v R L u pl eH id e K S K S v RO O g 1.0 h 1.0 ** *** ns 0.8 0.8 ** 0.6 0.6 ns ns ns ns 0.4 ns ns ns 0.4ns ns 0.2 ns 0.2 0.0 0.0 ai n ey ng en r t ct na in eya i a n g en ar t t a r dn u le e du et r dn c u n B i L p i B i L pl e e u tiid e K S H v RO K S H v R O 42 www.biolcell.net | Volume (112) | Pages 39–52 Bbs9 expression relative Bbs7 expression relative Bbs4 expression relative Bbs1 expression relative to Gapdh (1/ΔCT) to Gapdh (1/ΔCT) to Gapdh (1/ΔCT) to Gapdh (1/ΔCT) Bbs18 expression relative Bbs8 expression relative Bbs5 expression relative Bbs2 expression relative to Gapdh (1/ΔCT) to Gapdh (1/ΔCT) to Gapdh (1/ΔCT) to Gapdh (1/ΔCT) Tissue-dependent differences in Bardet–Biedl syndrome gene expression Research article Figure 2 Relative expression of BBSome transcripts Pie charts showing relative gene expression of Bbs1,2,4,5,7,8,9,18 in each tissue. Total expression of all BBSome transcripts is set at 100%. n = 4 for all genes, Bbs8 n = 3. a b c d Brain Kidney Lung Spleen e f g Bbs1 Bbs2 Bbs4 Bbs5 Bbs7 Bbs8 Bbs9 Heart Oviduct Retina Bbs18 to the trend seen for the BBSome transcripts. The analysed (Figure 4a–n). We did not see a signifi- one transcript that stands out is Bbs12, which is cant increase in mRNA expression of other BBSome comparatively more abundant in spleen, oviduct and subunits in an attempt to compensate for the loss. retina (Figure 3f–j). Overall, relative chaperonin-like Intriguingly, the expression of Bbs7 was significantly Bbs expression levels within a specific tissue was lower in all knock out tissues tested, while Bbs9 did less variable across tissues as compared to BBSome not show any significant changes in expression (Fig- transcripts (Figures 3d–j and 2a–g). ures 4e and 4f). Bbs18 was only downregulated in heart. Similar to what was observed above, expression Loss of Bbs8 leads to altered expression of other patterns in brain and kidney were remarkably simi- Bbs transcripts lar. In these two tissues, only Bbs7 was significantly Previous studies from our lab have shown aberrant downregulated (Figures 4h and 4i). This could possi- gene expression of ciliary proteins upon loss of BBS bly suggest a similar mechanism of transcriptional function [Patnaik et al., 2019]; however, very little is control in these two organs. Other organs (lung, known about the transcriptional control of BBSome spleen, heart, oviduct, and retina) have numerous genes upon loss of one subunit. To assess the expres- BBSome subunits that are significantly less expressed sion of BBSome subunits in the absence of Bbs8/Ttc8, in Bbs8−/− mice compared to control (Figure 4j–n). we utilised a knock out mouse model. We measured Since Bbs3 (Arl6) has extremely close functional links mRNA expression levels of the other seven BBSome to the BBSome [Fan et al., 2004; Klink et al., 2017], components as well as the three chaperonin-like genes we also analyzed the expression levels of this gene in in tissues harvested from adult Bbs8+/+ and Bbs8−/− Bbs8−/− tissues.We found thatBbs3 had a unique pat- littermate mice. tern of expression change that did not resemble any We observed significant changes in BBSome of the changes in expression for individual BBSome mRNA levels in the absence ofBbs8 suggesting a pos- components (Supporting Information Figure 2a). sible transcriptional control mechanism (Figure 4a– We next assessed the mRNA expression levels of n). mRNA levels were either lower or unchanged chaperonin-like components in Bbs8+/+ and Bbs8−/− in Bbs8−/− mice compared to Bbs8+/+ in all tissues tissues (Figure 5a–j). Again, we observe tissue- and ©C 2019 The Authors. Biology of the Cell published by Wiley-VCH Verlag GmbH & Co. KGaA on behalf of Société Française des Microscopies and Société de 43 Biologie Cellulaire de France S. R. Patnaik and others Figure 3 Expression of BBS chaperonin-like transcripts a–c) Bar chart showing gene expression of Bbs6, Bbs10 and Bbs12 in different tissues relative to Gapdh. Relative expression levels of each sample averaged. Error bars show standard error of the mean. Statistics were done using the Dunnett’s multiple comparison test *p  0.05; ns not significant. d–j) Pie charts showing relative gene expression of Bbs6/Mkks, Bbs10 and Bbs12 in each tissue. Total expression of all Bbs-chaperonin transcripts is set at 100%. n = 5 for Bbs10 and 12, Bbs6 n = 3. a b c 0.6 0.20 0.3 ns ns ns ns ns ns * ns ns ns 0.15 ns ns0.4 0.2 ns ns ns ns ns ns0.10 0.2 0.1 0.05 0.0 0.00 0.0 in ey ng en r t ct na in ey g en rt ct a in y t t ra n u e a u ti ra n un e a u tin a ner un g en are uc n a B id L pl eH id e B id L p l e l e ti K S v R K S H v id eR B id L p i d e O O K S H v R O d e f g Brain Kidney Lung Spleen h i j Bbs6 Bbs10 Bbs12 Heart Oviduct Retina gene-dependent differences. Loss of Bbs8 affected the an increase in expression of an alternative Bbs gene. expression levels of all three transcripts, Bbs6/Mkks, When focusing on individual tissues, brain and retina Bbs10 and Bbs12, variably (Figure 5a–c). In mu- had a similar change in expression pattern, as well tant mice Bbs6 expression was reduced compared as lung and heart (Figures 5d, 5j, 5f and 5h). De- to control in brain, oviduct and retina, while Bbs10 creased expression of Bbs6 is only compensated by showed lower expression in lung and heart (Figures 5a increased expression of Bbs12 in oviduct (and not in and 5b). The expression of Bbs12 was comparable brain or retina). This highlights a possible importance between mutant and control with the exception of of Bbs6 in the reproductive system. The expression of oviduct, in which Bbs12 was increased (Figure 5c). chaperonin-like genes were unaffected in kidney and This was the only case in which loss of Bbs8 lead to spleen (Figures 5e and 5g). 44 www.biolcell.net | Volume (112) | Pages 39–52 Bbs6 expression relative to Gapdh (1/ΔCT) Bbs10 expression relative to Gapdh (1/ΔCT) Bbs12 expression relative to Gapdh (1/ΔCT) Tissue-dependent differences in Bardet–Biedl syndrome gene expression Research article Figure 4 Expression of BBSome transcripts in Bbs8−/− tissues a–g) Bar chart showing gene expression ofBbs1,2,4,5,7,8,9,18 in different tissues fromBbs8−/− tissues relative to controlBbs8+/+ (red line). Coloured bars indicate significantly downregulated genes. Relative expression levels of each sample averaged. Error bars show standard error of the mean. ***p  0.001,**p  0.01,*p  0.05. h–n) Graphical representation of different tissue with respective genes downregulated (coloured boxes) in Bbs8−/− tissues relative to control. Experiments were performed in triplicates from three individual animals. a b c Retina *** Retina ** Retina * Oviduct *** Oviduct ** Oviduct ** Heart * Heart * Heart * Spleen Spleen ** Spleen ** Lung ** Lung Lung ** Kidney Kidney Kidney Brain Brain Brain 0. 0 5 0. 1. 0 1. 5 0. 0 0. 5 .0 .5 .0 .2 41 1 0 0 0. 0. 6 .80 1. 0 Bbs1 Fold Change Bbs2 Fold Change Bbs4 Fold Change d e f Retina ** Retina *** Retina Oviduct Oviduct *** Oviduct Heart * Heart *** Heart Spleen * Spleen *** Spleen Lung Lung ** Lung Kidney Kidney *** Kidney Brain Brain *** Brain 0 0. 0. 5 .0 .51 1 0. 0 .2 40 0. 0. 6 8 0 0. 1. .0 .0 0 0 00 1 2. 3. 4. Bbs5 Fold Change Bbs7 Fold Change Bbs9 Fold Change g Retina Oviduct Heart * Spleen Lung Kidney Brain .0 .5 .0 .5 .00 0 1 1 2 Bbs18 Fold Change h i j Brain Bbs2 Bbs7 Kidney Bbs2 Bbs7 Lung Bbs2 Bbs7 Bbs4 Bbs18 Bbs8 Bbs9 Bbs1 Bbs4 Bbs18 Bbs8 Bbs9 Bbs1 Bbs4 Bbs18 Bbs8 Bbs9 Bbs1 Bbs5 Bbs5 Bbs5 k l m Spleen Bbs2 Bbs7 Heart Bbs2 Bbs7 Oviduct Bbs2 Bbs7 Bbs4 Bbs18 Bbs8 Bbs9 Bbs1 Bbs4 Bbs18 Bbs8 Bbs9 Bbs1 Bbs4 Bbs18 Bbs8 Bbs9 Bbs1 Bbs5 Bbs5 Bbs5 n Retina Bbs2 Bbs7 Bbs4 Bbs18 Bbs8 Bbs9 Bbs1 decrease Bbs5 ©C 2019 The Authors. Biology of the Cell published by Wiley-VCH Verlag GmbH & Co. KGaA on behalf of Société Française des Microscopies and Société de 45 Biologie Cellulaire de France S. R. Patnaik and others Figure 5 Expression of BBS chaperonin-like transcripts in Bbs8−/− tissues a–c) Bar chart showing gene expression of Bbs6, 10 and 12 in different tissues from Bbs8−/− tissues relative to control Bbs8+/+ (red line). Purple coloured bars indicate significantly downregulated genes, blue coloured bar indicates significantly upregulated gene. Relative expression levels of each sample averaged. Error bars show standard error of the mean. ***p  0.001, **p  0.01, *p  0.05. d–j) Graphical representation of different tissues with respective genes downregulated or upregulated (coloured boxes) in Bbs8−/− tissues relative to control. Purple indicates significantly downregulated genes, blue significantly upregulated genes. Experiments were performed in triplicates from three individual animals. a b c Retina * Retina Retina Oviduct *** Oviduct Oviduct ** Heart Heart * Heart Spleen Spleen Spleen Lung Lung * Lung Kidney Kidney Kidney Brain * Brain Brain 0 5 0 0. 0. 1. 1. 5 .0 .5 0 5 .0 .0 .0 .0 .00 0 1. 1. 0 2 4 6 8 Bbs6 Fold Change Bbs10 Fold Change Bbs12 Fold Change d e f Brain Kidney Lung Bbbbss67 Bbs6 Bbs6 Bbs8 Bbs8 Bbs8 Bbs10 Bbs12 Bbs10 Bbs12 Bbs10 Bbs12 g h i Spleen Heart Oviduct Bbs6 Bbs6 Bbs6 Bbs8 Bbs8 Bbs8 Bbs10 Bbs12 Bbs10 Bbs12 Bbs10 Bbs12 j Retina Bbs6 decrease Bbs8 increase Bbs10 Bbs12 Effect of Bbs6 loss on other Bbs transcripts pression was increased (Figure 6k). This increased Lastly, we examined the loss of a BBS chaperonin- expression (albeit only in spleen and lung) is in like component on Bbs transcript expression. We contrast to the decreased expression of BBSome started by analysing the expression variability of transcripts in Bbs8−/− mice. As for the Bbs8−/− BBSome components in different tissues in Bbs6−/− tissue, we also analyzed the expression levels of Bbs3 adult mice compared to Bbs6+/+ littermate controls. in Bbs6−/− tissues. Similarly, we found that Bbs3 also Perhaps unsurprisingly, in contrast to Bbs8−/− mu- had a unique pattern of expression change upon loss tant mice, the expression of BBSome mRNA re- of Bbs6 (Supporting Information Figure 2b). mained stable in most tissues compared to the con- Similar to the BBSome transcripts, expression lev- trol, with the exception of spleen and lung (Fig- els of chaperonin-like components were also less vari- ure 6a–o). All BBSome components except for Bbs2 able in Bbs6−/− adult mice compared to controls showed significantly higher expression in spleen (Fig- (Figure 7a–i). The only differences were observed in ure 6l). In Bbs6−/− lung Bbs2, Bbs4 and Bbs18 ex- spleen, in which Bbs10 was significantly increased 46 www.biolcell.net | Volume (112) | Pages 39–52 Tissue-dependent differences in Bardet–Biedl syndrome gene expression Research article Figure 6 Expression of BBSome transcripts in Bbs6−/− tissues a–h) Bar chart showing gene expression of Bbs1,2,4,5,7,8,9,18 in different tissues from Bbs6−/− tissues relative to control (red line). Coloured bars indicate significantly upregulated genes. Relative expression levels of each sample averaged. Error bars show standard error of the mean. ***p  0.001, **p  0.01, *p  0.05. i–o) Graphical representation of different tissues with respective genes upregulated (coloured boxes) in Bbs6−/− tissues relative to control. Experiments were performed in triplicates from three individual animals. a b c Retina Retina Retina Oviduct Oviduct Oviduct Heart Heart Heart Spleen *** Spleen Spleen *** Lung Lung *** Lung *** Kidney Kidney Kidney Brain Brain Brain 0 2 4 6 8 10 0 1 2 3 0 1 2 3 4 5 Bbs1 Fold Change Bbs2 Fold Change Bbs4 Fold Change d e f Retina Retina Retina Oviduct Oviduct Oviduct Heart Heart Heart Spleen *** Spleen *** Spleen *** Lung Lung Lung Kidney Kidney Kidney Brain Brain Brain 0 2 4 6 8 0 2 4 6 8 0 2 4 6 8 Bbs5 Fold Change Bbs7 Fold Change Bbs8 Fold Change g h Retina Retina Oviduct Oviduct Heart Heart Spleen *** Spleen ** Lung Lung * Kidney Kidney Brain Brain 0 1 2 3 4 0 1 2 3 4 Bbs9 Fold Change Bbs18 Fold Change i j k Brain Bbs6 Bbs2 Bbs7 Kidney Bbs6 Bbs2 Bbs7 Lung Bbs6 Bbs2 Bbs7 Bbs4 Bbs18 Bbs8 Bbs9 Bbs1 Bbs4 Bbs18 Bbs8 Bbs9 Bbs1 Bbs4 Bbs18 Bbs8 Bbs9 Bbs1 Bbs5 Bbs5 Bbs5 l m n Spleen Bbs6 Bbs2 Bbs7 Heart Bbs6 Bbs2 Bbs7 Oviduct Bbs6 Bbs2 Bbs7 Bbs4 Bbs18 Bbs8 Bbs9 Bbs1 Bbs4 Bbs18 Bbs8 Bbs9 Bbs1 Bbs4 Bbs18 Bbs8 Bbs9 Bbs1 Bbs5 Bbs5 Bbs5 o Retina Bbs6 Bbs2 Bbs7 Bbs4 Bbs18 Bbs8 Bbs9 Bbs1 increase Bbs5 ©C 2019 The Authors. Biology of the Cell published by Wiley-VCH Verlag GmbH & Co. KGaA on behalf of Société Française des Microscopies and Société de 47 Biologie Cellulaire de France S. R. Patnaik and others Figure 7 Expression of BBS chaperonin-like transcripts in Bbs6−/− tissues a and b) Bar chart showing gene expression of Bbs6, 10 and 12 in different tissues from Bbs6−/− tissues relative to control (red line). Blue coloured bar indicates significantly upregulated gene, purple coloured bars indicates significantly downregulated gene. Relative expression levels of each sample averaged. Error bars show standard error of the mean. ***p 0.001, **p 0.01,*p 0.05. c–i) Graphical representation of different tissues with respective genes upregulated or downregulated (coloured boxes) in Bbs6−/− tissues relative to control. Blue indicates significantly upregulated genes, purple significantly downregulated genes. Experiments were performed in triplicates from three individual animals. a b Retina Retina Oviduct Oviduct Heart Heart * Spleen *** Spleen Lung Lung Kidney Kidney Brain Brain .0 .0 .0 .0 .0 .0 .5 0 5 00 1 2 3 4 0 0 1. 1. 2. Bbs10 Fold Change Bbs12 Fold Change c d e Brain Kidney Lung Bbbbss67 Bbbbss67 Bbbbss67 Bbs10 Bbs12 Bbs10 Bbs12 Bbs10 Bbs12 f g h Spleen b Heart OviductBbbss67 Bbbbss67 Bbbbss67 Bbs10 Bbs12 Bbs10 Bbs12 Bbs10 Bbs12 i Retina Bbbbss67 decrease increase Bbs10 Bbs12 (Figure 7a and 7f), and in heart in which Bbs12 was the BBSome proteins (BBS1, 2, 4, 5, 7, 8, 9 and 18) significantly decreased (Figures 7b and 7g). Overall, form an octomeric protein complex that bind GPCRs loss of the chaperonin-like component Bbs6 did not and other receptors as a cargo adaptor during IFT have a profound effect on transcripts encoding BB- [Nachury et al., 2007; Klink et al., 2017; Liu and Some or chaperonin-like mRNA expression. Lechtreck, 2018]. In particular, BBSome-mediated trafficking is crucial for retrieval of GPCRs back into the cell [Wei et al., 2012; Nager et al., 2017; Ye Discussion et al., 2018]. The BBS chaperonin-like genes encode Mutations in BBS genes cause a multitude of proteins (BBS6, 10, 12) that form a complex with phenotypes affecting various organs and tissues. The the CCT/TRiC family chaperonins which is essential predominant understanding is that BBS proteins fa- for BBSome assembly. However, the idea that BBS cilitate ciliary membrane trafficking. In this context, proteins are only functional in a ciliary context 48 www.biolcell.net | Volume (112) | Pages 39–52 Tissue-dependent differences in Bardet–Biedl syndrome gene expression Research article might be an oversimplification. In recent years, increase in mRNA expression of other BBSome sub- there has been increasing interest in highlighting units that would suggest compensation for the loss functions of ciliary proteins at extra-ciliary sites of Bbs8. Interestingly there was little consistency in and in non-ciliary contexts. Such functions include which transcripts were affected with the exception of intracellular trafficking, regulation of the cytoskele- Bbs7, which was significantly decreased in all tissues ton, mitosis, cell cycle regulation, regulation of the examined, and Bbs9, which was stable across tissues. DNA damage response and transcriptional control Loss of Bbs8 also affected the expression of individ- [Vertii et al., 2015; Hua and Ferland, 2018]. Several ual chaperonin-like genes differently. Bbs6 and Bbs10 studies also suggest that some of the BBS proteins were decreased in several tissues. In contrast, Bbs12 might take on extra-ciliary roles, possibly in a was found to be upregulated in oviduct. As in the non BBSome/chaperonin dependent manner that control tissues, several tissues "responded" in a sim- could be relevant to the aetiology of the disorder ilar manner, such as brain and kidney in terms of [Novas et al., 2015]. Alternative functions might be BBSome transcripts and brain and retina in terms of dependent on both time point and tissue type. chaperonin-like transcripts, alluding to similar func- To gain more insight into BBS functionality, we set tionalities of these molecules in these tissues. out to examine whether relative gene expression for Loss of BBS chaperonin-like component Bbs6 had individual BBS genes was constant across different little effect on the expression of BBSome transcripts tissues. We wanted to test the stoichiometric compo- in most tissues, yet surprisingly virtually all BBSome sition of Bbs at the level of mRNA across tissues. We mRNAs in spleen and half in lung were upregulated. postulated that if the BBSome and Bbs chaperonin- This might suggest that Bbs6 has some alternative like genes only encode proteins that function in a role in spleen and lung tissue that is not present in defined complex, then their relative expression lev- any of the other tissues. Loss ofBbs6 also increased the els should be stoichiometrically conserved between expression of the other chaperonin-like component, different tissues. Bbs10, but only in spleen. Again, this suggests a pos- We found that Bbs transcripts are differentially sible alternative molecular function of Bbs6, which is expressed in different tissues. Overall, there was a possibly more prevalent in spleen. Although spleen higher degree of variation among BBSome transcripts defects are not readily reported in BBS patients. as opposed to BBS chaperonin-like transcripts. These Since alternative splicing can produce transcripts results suggested possible tissue-dependent differ- with different stabilities, we designed primers to ences in BBSome composition and/or protein half- recognise as many of the different BBS transcripts life, or that some of these transcripts might also be re- as possible. Nonetheless, alternative transcripts quired for alternative non-BBSome-related functions could result in different mRNA levels, which might in different tissues. A more stoichiometric expression contribute to the differences in expression levels of BBS chaperonin-like transcripts suggests that their described above. Absolute expression values must individual functions might be more closely coupled. always be measured in relation to a housekeeping Interestingly, several tissues had similar distribution control the selection of which is crucial. We chose of expression, which might allude to similar func- Gapdh, since it was the best option available to tionality on a molecular level. For example in brain us, but are aware that variation in expression of and in kidney, the stoichiometry of both BBSome housekeeping controls across tissues, which can and BBS chaperonin-like transcripts were more sim- always distort comparisons. ilar compared to other tissues. While our approach reveals differences in tran- When we analysed mRNA expression of other BB- scription that presumably affect protein abundance Some components upon loss of BBSome component and consequent function, we were unable to show Bbs8, we observed that numerous transcripts were de- this directly due to technical limitations related creased, which might suggest a transcriptional con- to BBS proteins. Antibodies against these proteins trol mechanism. Alternatively loss of Bbs8 might are notoriously inconsistent and difficult to use. have a stronger impact on tissue health or function Numerous Western blots were performed using and therefore a greater impact on overall gene tran- various tissues but give that certain antibodies failed scription. Surprisingly, we did not see a significant or either detected bands at incorrect sizes or in knock ©C 2019 The Authors. Biology of the Cell published by Wiley-VCH Verlag GmbH & Co. KGaA on behalf of Société Française des Microscopies and Société de 49 Biologie Cellulaire de France S. R. Patnaik and others out tissues, the data were unreliable. To overcome In conclusion, we have seen that Bbs transcripts are issues related to antibody specificity, protein abun- not stoichiometrically expressed in different tissues dance was also quantified via mass spectroscopy but and that loss of Bbs function affects expression of proved imprecise due to the relatively low abundance other transcripts differently. These data support the of Bbs proteins in each sample. hypothesis that in some tissues at least, BBS proteins As mentioned above previous studies have already do not only function in a complex butmight also have shown that BBS protein functions are not restricted alternative functions in a ciliary independent context to the primary cilium. Such functions include independent of one another. intracellular trafficking. BBSome components have been found to assist retrograde dynein mediated melanosome transport in zebrafish [Yen et al., 2006] Materials and methods as well as trafficking of various receptor molecules AnimalsAll mouse work was performed as per ethical approval from ap- (Notch and Vangl2) to the cell membrane [Leitch propriate governing bodies. Experiments were performed in ac- et al., 2014; May-Simera et al., 2015]. An active cordance with guidelines provided by Association for Research role in regulation of the cytoskeleton has also been in Vision and Ophthalmology (ARVO). Animals were main- shown for BBS4, 6 and 8 via manipulation of tained on a cycle of 12 hours of light (200 lux) and 12 hours ofdarkness. The generation and characterisation of Bbs6/Mkks and actin polymerisation [Hernandez-Hernandez et al., Bbs8/Ttc8 knock out (KO) mice have been previously described. 2013]. Associations with the centrosome, centriolar For analysis of wild-type tissues, organs were harvested from satellites and the mid body might also underlie C57BL/6 mice aged between 6 and 8 months. For comparison BBS4 and 6 facilitation of cell cycle regulation and between control and Bbs knock out tissues, littermate controls of the same age were used in all experiments. mitosis [Kim et al., 2004, 2005; Zhang et al., 2014]. More recently, there have been reports showing that Biological materials several BBS proteins enter the nucleus where they Mice were euthanised by cervical dislocation. Brain, kidney, can influence gene expression through interactions lung, spleen, heart, oviduct and retina tissue samples were dis- with the polycomb group member protein RNF2 sected from adult female mice. Tissues were placed immediately [Gascue et al., 2012; Scott et al., 2017]. in TRIzol Reagent (Thermo Fisher Scientific) (for RNA) or snap frozen (for Western blotting) and stored at −80°C until further Although our results suggest BBS proteins might use. have alternative functions independent of each other in different tissues, it is important to mention the RNA isolation evidence that argues against this hypothesis. Over- Total RNA was isolated from tissue samples using TRIzol all there is little evidence of a genotype–phenotype Reagent (Thermo Fisher Scientific). Tissues were homogenised©R relationship among individuals affected with BBS, using a FastPrep -24 classic (MP Biomedicals) bead-basher at a setting of six (6 m/s) for 20–60 s, periodically placing the sam- with a lack of tissue-specific defects in BBS patients ples on ice in between pulses. RNA extraction was performed carrying mutations in different BBS genes. The one according to manufacturer’s instructions and stored at −80°C. exception here is the renal phenotype. A recent meta- RNA quality and quantity were measured using a Nanodrop analysis study in the Czech Republic found that the ND-1000 spectrophotometer (Thermo Fisher Scientific) follow- core BBSome subunits BBS2, 7 and 9 manifest as ingmanufacturer’s instructions. Only samples with anOD260/280reading between 1.8 and 2.1 were used for gene qRT-PCR ex- more critical in the kidney [Niederlova et al., 2019]. periments. Similarly, the risk factor for severe renal disease were found to vary between patients harbouring BBS1, 2, Reverse transcription and qRT-PCR 9, 10 or 12 mutations in a detailed study with 350 For analysis of target gene mRNA expression, 4 µg of RNA was BBS patients in the UK [Forsythe et al., 2017]. An reverse transcribed into cDNA in a 20 µL reaction volume us- additional argument is that most functionally tagged ing the SuperScript TM III first-strand synthesis system (Thermo Fisher Scientific) according to manufacturer’s instructions. BBSome proteins tend to show the same expression Reverse transcription products were diluted in DEPC H2O. pattern (exclusively ciliary localisation) in cultured The cDNA was diluted 1:50 or 1:20 while using Gapdh or cells [Barbelanne et al., 2015; Ye et al., 2018]. Lastly, Bbs primers respectively. One microliter of the diluted cDNA biochemical analyses have shown that the BBSome was used in each qPCR reaction, with a total volume of 10 µl.©R qRT-PCR amplification was performed using the SYBR -Green proteins consistently build one stable functional com- reagent (Life Technologies) on a Step One PlusTM Real-Time plex [Nachury et al., 2007; Klink et al., 2017]. PCR machine (Applied Biosystems; Thermo Fisher Scientific, 50 www.biolcell.net | Volume (112) | Pages 39–52 Tissue-dependent differences in Bardet–Biedl syndrome gene expression Research article Inc.). The thermocycler conditions were as follows: Initial de- Conflict of interest statement naturation at 95°C for 10 min, followed by 40 cycles of 95°C The authors have declared no conflict of interest. for 10 s, 60°C for 30 s; and a final extension at 72°C for 1 min. mRNA expression of the Bbs genes were calculated using the 2−Ct method. All primer sequences used for qRT-PCR analysis are listed below (Table 1). References Melt curve analysis was performed to assess the amplification Barba, M., Di Pietro, L., Massimi, L., Geloso, M.C., Frassanito, P., of single specific product (Supporting Information Figure 3). Caldarelli, M., Michetti, F., Della Longa, S., Romitti, P.A., Di Rocco, Primer amplification efficiency was determined prior to carrying C., Arcovito, A., Parolini, O., Tamburrini, G., Bernardini, C., out qPCR analysis (Table 1). Since alternative splicing can pro- Boyadjiev, S.A. and Lattanzi, W. (2018) BBS9 gene in duce transcripts with different stabilities, we designed primers nonsyndromic craniosynostosis: Role of the primary cilium in the to recognise as many of the different BBS transcripts as possible aberrant ossification of the suture osteogenic niche. Bone 112, (Table 1). 58–70 Barbelanne, M., Hossain, D., Chan, D.P., Peränen, J. and Tsang, W.Y. ‘Ct’ is the difference in expression of a gene of interest (Bbs (2015) Nephrocystin proteins NPHP5 and Cep290 regulate genes) and the reference gene, namely Gapdh. ‘1/Ct’ termed BBSome integrity, ciliary trafficking and cargo delivery. Hum. Mol. as ‘expression factor’ was used to show the relative gene expres- Genet. 24, 2185–200 sion across tissues. The expression factor (mean of 1/Ct values) Datta, P., Allamargot, C., Hudson, J.S., Andersen, E.K., Bhattarai, S., was used to make the pie charts. The expression factors of BB- Drack, A. V, Sheffield, V.C. and Seo, S. (2015) Accumulation of Some mRNAs (Bbs1, Bbs2, Bbs4, Bbs5, Bbs7, Bbs8, Bbs9 and non-outer segment proteins in the outer segment underlies Bbs18) in different organs were normalised to either brain or photoreceptor degeneration in Bardet-Biedl syndrome. Proc. Natl. heart. The sum of normalised values of all BBSome components Acad. Sci. U. S. A. 112, E4400-9 in each organ was set as 100%. The percentage expression of in- Ezratty, E.J., Stokes, N., Chai, S., Shah, A.S., Williams, S.E. and Fuchs, E. (2011) A role for the primary cilium in notch signaling and dividual Bbs gene was calculated and represented as a pie chart. epidermal differentiation during skin development. Cell 145, Similarly, all three chaperonin-like gene expression percentages 1129–1141 (Bbs6, Bbs10 and Bbs12) are plotted as pie charts. Fan, Y., Esmail, M. A., Ansley, S.J., Blacque, O.E., Boroevich, K., Ross, A.J., Moore, S.J., Badano, J.L., May-Simera, H., Compton, D.S., Green, J.S., Lewis, R.A., van Haelst, M.M., Parfrey, P.S., Statistical Analysis Baillie, D.L., Beales, P.L., Katsanis, N., Davidson, W.S. and Leroux, Statistical differences between multiple groups were assessed us- M.R. (2004) Mutations in a member of the Ras superfamily of small ing ANOVA followed by Dunnett’s multiple comparison test GTP-binding proteins causes Bardet-Biedl syndrome. Nat. Genet. (GraphPad Prism 6.0, GraphPad Software, San Diego, CA). Er- 36, 989–993 ror bars represent the mean ± standard deviation. Results are Forsythe, E. and Beales, P.L. (2013) Bardet–Biedl syndrome. Eur. J. considered statistically significant if *p < 0.05. Hum. Genet. 21, 8–13 Forsythe, E., Sparks, K., Best, S., Borrows, S., Hoskins, B., Sabir, A., Barrett, T., Williams, D., Mohammed, S., Goldsmith, D., Milford, D. V., Bockenhauer, D., Foggensteiner, L. and Beales, P.L. (2017) Risk Author Contribution factors for severe renal disease in Bardet–Biedl syndrome. J. Am. S.R.P. and H.L.M.-S. were responsible for conception Soc. Nephrol. 28, 963–970Gascue, C., Tan, P.L., Cardenas-Rodriguez, M., Libisch, G., and experimental design. S.R.P., A.F., A.-K.V., L.B., Fernandez-Calero, T., Liu, Y.P., Astrada, S., Robello, C., Naya, H., S.S. and V.K. carried out experimental work. S.R.P. Katsanis, N. and Badano, J.L. (2012) Direct role of Bardet-Biedl syndrome proteins in transcriptional regulation. J. Cell Sci. 125, generated figures. S.R.P. and H.L.M.-S. co-wrote the 362–375 manuscript. Goetz, S.C. and Anderson, K.V. (2010) The primary cilium: a signalling centre during vertebrate development. Nat. Rev. Genet. 11, 331–344 Habbig, S., Bartram, M.P., Muller, R.U., Schwarz, R., Andriopoulos, Funding N., Chen, S., Sagmuller, J.G., Hoehne, M., Burst, V., Liebau, M.C., This work was supported by the Alexander Von Reinhardt, H.C., Benzing, T. and Schermer, B. (2011) NPHP4, a cilia-associated protein, negatively regulates the Hippo pathway. J. Humboldt Foundation, Johannes Gutenberg Univer- Cell Biol. 193, 633–642 sity, Mainz and the Deutsche Forschungs Gemein- Hernandez-Hernandez, V., Pravincumar, P., Diaz-Font, A., schaft (SPP2127). May-Simera, H., Jenkins, D., Knight, M. and Beales, P.L. (2013) Bardet-Biedl syndrome proteins control the cilia length through regulation of actin polymerization. Hum. Mol. Genet. 22, 3858–3868 Acknowledgements Hua, K. and Ferland, R.J. (2018) Primary cilia proteins: ciliary and The authors would like to thank Petra Gottlöber, extraciliary sites and functions. Cell. Mol. Life Sci. 75, 1521–1540 Ishikawa, H. and Marshall, W.F. (2011) Ciliogenesis: building the cell’s Jana Kurpinski and Rike Hähnel for their technical antenna. Nat. Rev. Mol. Cell Biol. 12, 222–234 assistance. They would also like to acknowledge the Jin, H., White, S.R., Shida, T., Schulz, S., Aguiar, M., Gygi, S.P., unwavering commitment of the animal care teams at Bazan, J.F. and Nachury, M. V (2010) The conserved Bardet-Biedlsyndrome proteins assemble a coat that traffics membrane the JGU, Mainz that made this research possible. proteins to cilia. Cell 141, 1208–1219 ©C 2019 The Authors. Biology of the Cell published by Wiley-VCH Verlag GmbH & Co. KGaA on behalf of Société Française des Microscopies and Société de 51 Biologie Cellulaire de France S. R. Patnaik and others Kim, J.C., Badano, J.L., Sibold, S., Esmail, M.A., Hill, J., Hoskins, syndrome proteins regulate cilia disassembly during tissue B.E., Leitch, C.C., Venner, K., Ansley, S.J., Ross, A.J., Leroux, maturation. Cell. Mol. Life Sci. 76, 757–775 M.R., Katsanis, N. and Beales, P.L. (2004) The Bardet-Biedl protein Schaefer, E., Delvallée, C., Mary, L., Stoetzel, C., Geoffroy, V., BBS4 targets cargo to the pericentriolar region and is required for Marks-Delesalle, C., Holder-Espinasse, M., Ghoumid, J., Dollfus, microtubule anchoring and cell cycle progression. Nat. Genet. 36, H. and Muller, J. (2019) Identification and characterization of 462–470 known biallelic mutations in the IFT27 (BBS19) gene in a novel Kim, J.C., Ou, Y.Y., Badano, J.L., Esmail, M.A., Leitch, C.C., Fiedrich, family with Bardet-Biedl syndrome. Front. Genet. 10, 21 E., Beales, P., Archibald, J.M., Katsanis, N., Rattner, J.B. and Schneider, L., Clement, C.A., Teilmann, S.C., Pazour, G.J., Leroux, M.R. (2005) MKKS/BBS6, a divergent chaperonin-like Hoffmann, E.K., Satir, P. and Christensen, S.T. (2005) PDGFRαα protein linked to the obesity disorder Bardet-Biedl syndrome, is a signaling is regulated through the primary cilium in fibroblasts. novel centrosomal component required for cytokinesis. J. Cell Sci. Curr. Biol. 15, 1861–1866 118, 1007–1020 Scott, C.A., Marsden, A.N., Rebagliati, M.R., Zhang, Q., Chamling, Klink, B.U., Zent, E., Juneja, P., Kuhlee, A., Raunser, S. and X., Searby, C.C., Baye, L.M., Sheffield, V.C. and Slusarski, D.C. Wittinghofer, A. (2017) A recombinant BBSome core complex and (2017) Nuclear/cytoplasmic transport defects in BBS6 underlie how it interacts with ciliary cargo. Elife 6, e27434 congenital heart disease through perturbation of a chromatin Leitch, C.C., Lodh, S., Prieto-Echagüe, V., Badano, J.L. and remodeling protein. PLos Genet. 13, e1006936 Zaghloul, N.A. (2014) Basal body proteins regulate Notch signaling Seo, S., Baye, L.M., Schulz, N.P., Beck, J.S., Zhang, Q., Slusarski, through endosomal trafficking. J. Cell Sci. 127, 2407–2419 D.C. and Sheffield, V.C. (2010) BBS6, BBS10, and BBS12 form a May-Simera, H.L., Petralia, R.S., Montcouquiol, M., Wang, Y.-X., Liu, complex with CCT/TRiC family chaperonins and mediate Y., Szarama, K.B., Deans, M.R., Lin, W., Deans, M.R., Pazour, G.J. BBSome assembly. Proc. Natl. Acad. Sci. U. S. A. 107, and Kelley, M.W. (2015) Ciliary proteins Bbs8 and Ift20 promote 1488–1493 planar cell polarity in the cochlea. Development 142, 555–566 Vertii, A., Bright, A., Delaval, B., Hehnly, H. and Doxsey, S. (2015) Lindstrand, A., Frangakis, S., Carvalho, C.M.B., Richardson, E.B., New frontiers: discovering cilia-independent functions of cilia McFadden, K.A., Willer, J.R., Pehlivan, D., Liu, P., Pediaditakis, I.L., proteins. EMBO Rep. 16, 1275–1287 Sabo, A., Lewis, R.A., Banin, E., Lupski, J.R., Davis, E.E. and Wei, Q., Zhang, Y., Li, Y., Zhang, Q., Ling, K. and Hu, J.(2012) The Katsanis, N. (2016) Copy-number variation contributes to the BBSome controls IFT assembly and turnaround in cilia. Nat. Cell mutational load of Bardet-Biedl syndrome. Am. J. Hum. Genet. 99, Biol. 14, 950–957 318–336 Wormser, O., Gradstein, L., Yogev, Y., Perez, Y., Kadir, R., Goliand, I., Liu, P. and Lechtreck, K.F. (2018) The Bardet–Biedl syndrome protein Sadka, Y., El Riati, S., Flusser, H., Nachmias, D., Birk, R., Iraqi, M., complex is an adapter expanding the cargo range of intraflagellar Kadar, E., Gat, R., Drabkin, M., Halperin, D., Horev, A., Sivan, S., transport trains for ciliary export. Proc. Natl. Acad. Sci. U. S. A. Abdu, U., Elia, N. and Birk, O.S. (2019) SCAPER localizes to 115, E934–E943 primary cilia and its mutation affects cilia length, causing May-Simera, H.L. and Kelley, M.W. (2012) Cilia, Wnt signaling, and Bardet-Biedl syndrome. Eur. J. Hum. Genet. 27, 928–940 the cytoskeleton. Cilia. 1, 7 Ye, F., Nager, A.R. and Nachury, M.V. (2018) BBSome trains remove Nachury, M. V, Loktev, A. V, Zhang, Q., Westlake, C.J., Peranen, J., activated GPCRs from cilia by enabling passage through the Merdes, A., Slusarski, D.C., Scheller, R.H., Bazan, J.F., Sheffield, transition zone. J. Cell Biol. 217, 1847–1868 V.C. and Jackson, P.K. (2007) A core complex of BBS proteins Yen, H.J., Tayeh, M.K., Mullins, R.F., Stone, E.M., Sheffield, V.C. and cooperates with the GTPase Rab8 to promote ciliary membrane Slusarski, D.C. (2006) Bardet-Biedl syndrome genes are important biogenesis. Cell 129, 1201–1213 in retrograde intracellular trafficking and Kupffer’s vesicle cilia Nager, A.R., Goldstein, J.S., Herranz-Pérez, V., Portran, D., Ye, F., function. Hum. Mol. Genet. 15, 667–677 Garcia-Verdugo, J.M. and Nachury, M.V. (2017) An actin network Yuan, S., Zhao, L. and Sun, Z. (2013) Dissecting the functional dispatches ciliary gpcrs into extracellular vesicles to modulate interplay between the TOR pathway and the cilium in zebrafish. signaling. Cell 168, 252–263.e14 Methods Enzymol. 525, 159–189 Niederlova, V., Modrak, M., Tsyklauri, O., Huranova, M. and Zhang, Q., Yu, D., Seo, S., Stone, E.M. and Sheffield, V.C. (2012) Stepanek, O. (2019) Meta-analysis of genotype-phenotype Intrinsic protein-protein interaction-mediated and associations in Bardet-Biedl syndrome uncovers differences chaperonin-assisted sequential assembly of stable Bardet-Biedl among causative genes. Hum. Mutat. 40, 2068–2087 syndrome protein complex, the BBSome. J. Biol. Chem. 287, Novas, R., Cardenas-Rodriguez, M., Irigoı́n, F. and Badano, J.L. 20625–35 (2015) Bardet-Biedl syndrome: is it only cilia dysfunction? FEBS Zhang, Y., Seo, S., Bhattarai, S., Bugge, K., Searby, C.C., Zhang, Q., Lett. 589, 3479–3491 Drack, A. V, Stone, E.M. and Sheffield, V.C. (2014) BBS mutations Patnaik, S.R., Kretschmer, V., Brücker, L., Schneider, S., Volz, A.-K., modify phenotypic expression of CEP290-related ciliopathies. Oancea-Castillo, L.D.R. and May-Simera, H.L. (2019) Bardet-Biedl Hum. Mol. Genet. 23, 40–51 Received: 17 September 2019; Revised: 20 November 2019; Accepted: 28 November 2019; Accepted article online: 17 Decem- ber 2019 52 www.biolcell.net | Volume (112) | Pages 39–52 Publications & Manuscripts Publication II 21 Cellular and Molecular Life Sciences (2019) 76:757–775 https://doi.org/10.1007/s00018-018-2966-x Cellular and Molecular Life Sciences ORIGINAL ARTICLE Bardet–Biedl Syndrome proteins regulate cilia disassembly during tissue maturation Sarita Rani Patnaik1 · Viola Kretschmer1 · Lena Brücker1 · Sandra Schneider1  · Ann‑Kathrin Volz1 · Liliana del Rocio Oancea‑Castillo2 · Helen Louise May‑Simera1 Received: 19 April 2018 / Revised: 24 October 2018 / Accepted: 2 November 2018 / Published online: 16 November 2018 © Springer Nature Switzerland AG 2018 Abstract Primary cilia are conserved organelles that mediate cellular communication crucial for organogenesis and homeostasis in numerous tissues. The retinal pigment epithelium (RPE) is a ciliated monolayer in the eye that borders the retina and is vital for visual function. Maturation of the RPE is absolutely critical for visual function and the role of the primary cilium in this process has been largely ignored to date. We show that primary cilia are transiently present during RPE development and that as the RPE matures, primary cilia retract, and gene expression of ciliary disassembly components decline. We observe that ciliary-associated BBS proteins protect against HDAC6-mediated ciliary disassembly via their recruitment of Inversin to the base of the primary cilium. Inhibition of ciliary disassembly components was able to rescue ciliary length defects in BBS deficient cells. This consequently affects ciliary regulation of Wnt signaling. Our results shed light onto the mechanisms by which cilia-mediated signaling facilitates tissue maturation. Keywords Retinal dystrophy · Ciliopathy · Signaling pathways · Proteasomal degradation · Signaling inhibitors Introduction every cell type [5], not all cells retain their cilium throughout development and adulthood. In many tissues, for example Primary cilia are microtubule-based organelles that protrude the Organ of Corti in the mammalian cochlea [6], the lumi- from the cellular membrane and are anchored by modified nal epithelial cells within mammary gland [7] and corneal centrioles referred to as basal bodies. Cells use primary cilia endothelial cells in the eye [8], the cilium is vital during as specific sensory organelles to detect external cues and development but disassembles upon maturation. However, mediate intracellular signaling during cell differentiation, the physiological consequences of ciliary disassembly are organogenesis and tissue homeostasis. Cilia are involved largely unexplored. Cilia can disassemble in response to in several signaling pathways including Wingless-related environmental stress [9], during differentiation or cell cycle integration site (Wnt), Hedgehog (Hh) and platelet-derived progression [10, 11]. This shortening or absorption of the growth factor receptor α (PDGFRα) [1–4], are evolution- cilium will inevitably influence its signaling and functional ally conserved and vital for diverse organisms ranging from role [12–16]. metazoans to mammals. Although they are present on almost The importance of cilia during organogenesis and func- tion of the vertebrate eye is well documented, particularly in photoreceptor cells [17, 18]. However, we only recently Electronic supplementary material The online version of this showed that the retinal pigment epithelium (RPE), a pig- article (https: //doi.org/10.1007/s00018 -018-2966-x) contains mented monolayer epithelium essential for photoreceptor supplementary material, which is available to authorized users. development and visual function, also relies on the primary Helen Louise May-Simera cilium for maturation through the regulation of canonical * hmaysime@uni-mainz.de Wnt signaling [19]. Numerous reports have shown that RPE- derived cell lines are ciliated in vitro [20, 21] and although 1 Cilia Cell Biology, Institute of Molecular Physiology, ciliary assembly and disassembly pathways have been stud- Johannes-Gutenberg University, 55128 Mainz, Germany ied in these models, the precise mechanisms are still being 2 Institute of Developmental Biology and Neurobiology, determined. The effect of these processes on downstream Johannes-Gutenberg University, 55128 Mainz, Germany Vol.:(012 3456789) 758 S. R. Patnaik et al. signaling pathways has not been established [22, 23]. More- 13B (Arl13b) was used to identify primary cilia. Co-staining over, RPE ciliogenesis and ciliary disassembly have not been with other cilia (acetylated α-tubulin) and basal body mark- investigated in vivo. Although reports have suggested that ers (Pericentrin2, GT335) confirmed Arl13b as a reliable cilia in the RPE are retained throughout adulthood [24], cilia marker in the RPE (Fig. 1a, b; Supp. Figure 1a–d). a report from Nishiyama suggested that they disappear in Tight junction marker Zonula occludens-1 (ZO-1) (Fig. 1a, the adult rat RPE [25]. Therefore, we set out to investigate b; Supp. Figure 1b, c) and β-catenin were used as membrane the extent of ciliation in developing vertebrate RPE and to markers to visualize cell borders (Supp. Figure 1d). We per- understand the molecular mechanisms underlying ciliary formed stainings at various time points from E14.5 onward disassembly during development. and observed that the expression of primary cilia in the Various ciliary proteins including Bardet–Biedl Syn- developing RPE diminishes as the RPE matures (Fig. 1c–f). drome (BBS) and Nephronophthisis (NPHP) proteins show E14.5 was the earliest time point at which cilia were reliably ciliary localization [26] and regulate cilia length [27, 28]. observed and E18.5 was chosen instead of post-natal stages BBS proteins have been shown to direct ciliary trafficking, in order to circumvent embryonic lethality. The highest per- whereas many of the NPHP proteins function as ciliary gate- centage of ciliated cells was observed at E14.5 and E16.5 keepers [26, 28–31]. Certain mutations in the genes encod- (69.8 and 64%, respectively). By E18.5, only 26% of cells ing these proteins can cause severe ciliopathy phenotypes in the RPE were ciliated, suggesting that the primary cilium including retinal degeneration, cystic kidneys, central obe- had retracted in the majority of the cells (Fig. 1f). Changes sity and situs inversus [32, 33]. in cilia length accompanied cilia retraction, decreasing from Ciliary disassembly is known to be regulated by various 2.63 µm at E16.5 to 0.95 µm at E18.5 (Fig. 1g–j). In sup- cell cycle regulators. This process is mediated by human port of developmentally dependent transient expression of enhancer of filamentation 1 (HEF1/NEDD9) [34], which the primary cilium, we also observed differences in cilia- translocates from focal adhesions to the basal body, a struc- tion between the center and periphery of the RPE (compare ture derived from the mother centriole at the base of the Fig. 1c–e and Supp. Figure 1e–h). Ciliated cells were rarely cilium. Translocation of the scaffold protein HEF1 activates identified after E18.5. In P1 and adult RPE, only a few cells Aurora A kinase (AurA), which in turn activates histone could be identified with short stumpy Arl13b and acetylated deacetylase 6 (HDAC6), destabilizing the microtubule axo- α-tubulin positive cilia (Fig. 2a; Supp. Figure 1i–k). As pre- neme and thereby causing ciliary disassembly [22]. Inversin viously documented [42], we also observed a developmental (NPHP2) influences ciliary disassembly by regulating AurA increase in cell size (Fig. 1c–e, Supp. Figure 1e–g). Because [35] and Wnt signaling [36]. BBSome-interacting protein many cells were observed with cilia at embryonic time- 1 (BBIP10/BBS18), an accessory BBS protein, has been points, these data suggest that the primary cilium retracts shown to directly interact with HDAC6, thereby modulat- as the RPE develops. ing acetylation and stabilization of cytoplasmic microtubules To confirm retraction of the primary cilium in mature [37]. BBS proteins have also been shown to modulate Wnt RPE tissues, we prepared transmission electron micrographs signaling via degradation of β-catenin [19, 38, 39], which is (TEM) of mouse RPE at multiple time points and imaged controlled by precise coordination of phosphorylation and all identifiable basal body or ciliary axoneme profiles. All dephosphorylation events [40, 41]. profiles were classified into one of the three categories that In this study, we investigated the influence of ciliary dis- we defined as follows: basal bodies or centrioles with no assembly components in the developing RPE in vivo and attached membrane vesicles were categorized as Class I, in vitro. Furthermore, we sought to elucidate how BBS whereas Class II profiles were identified as basal bodies con- proteins mediate ciliary disassembly and how this influ- taining a membranous attachment (the ciliary vesicle). Class ences downstream signaling cascades involved in tissue III profiles were those with an extended ciliary axoneme into morphogenesis. the extracellular space (Fig. 2b). Class I profiles are likely over-represented as an artifact of sectioning through a basal body of a Class II and III structure that had an attached Results membrane or axoneme in a different cutting plane. Consist- ent with an increase in ciliary disassembly, the number of Primary cilia are transiently expressed Class III profiles decreased with RPE maturation (Fig. 2c). in the developing RPE Combined, these data are consistent with our observations on immunohistochemistry and imply that primary cilia dis- We characterized primary cilia expression in mouse flat- assemble upon maturation of the RPE. mount RPE at different stages of development using immu- To further support retraction of the primary cilium, nohistochemistry, RNA expression and electron microscopy. we measured changes in gene expression of two ciliary An antibody against ADP Ribosylation Factor-Like GTPase genes, Arl13b and Ift88 in isolated mouse RPE cells using 1 3 Bardet–Biedl Syndrome proteins regulate cilia disassembly during tissue maturation 759 Fig. 1 The primary cilium is transiently expressed during RPE development. Representa- tive high-resolution immuno- fluorescence images of E16.5 mouse RPE flatmounts labeled with antibodies against ciliary structures show co-localization of Arl13b and acetylated α-tubulin extending from the basal body (a, b). Arl13b (axo- neme marker, red); Pericentrin 2 (PCNT2, basal body marker, cyan); acetylated α-tubulin (Ac. tubulin, axoneme marker, cyan); Zona Occludens (ZO-1, cell junctions, green). Low magni- fication immunofluorescence images show ciliation (num- ber of ciliated cells) at three embryonic timepoints (c–e). Boxplots show a significant decrease in the number of cili- ated cells from E14.5 to E18.5 (f). E14.5 n = 1700 cells, E16.5 n = 750 cells, E18.5 n = 650 cells. Boxplots of cilia length demonstrate that mouse RPE cilia are longest at E16.5 (g). n = 25 for each age group. High- resolution immunofluorescence images of cilia (Arl13b, red) highlight differences in ciliary length between E14.5 and E18.5 (h–j) as quantified in g. Three or more animals were used per data set. Statistics were done using the Dunnett’s multiple comparison test ***p ≤ 0.001; ns not significant. Scale bars: a, b, h, i, j 2 µm; c–e 10 µm quantitative real-time PCR (qRT-PCR). We developed a Gapdh was taken as the housekeeping control as its expres- method to isolate pure RPE cells from embryonic mouse sion remained stable from E14.5 through to P7 in control eyes and confirmed cell purity by determining lack of choroi- and knockout mouse RPE (Supp. Figure 2d, e). Expression dal or retinal-specific gene expression (Supp. Figure 2a–c). of both cilia genes peaked at E16.5 and decreased as the 1 3 760 S. R. Patnaik et al. a b 80 Class I Class II Class III 60 40 20 0 c E16.5 P1 Adult E14.5 n=22 E16.5 n=36 P0 n=14 * * * P7 n=13 Adult n=19 0% 50% 100% Class I Class II Class III e d 1.5 e 1.5 1.0 * 1.0 *** 0.5 *** 0.5 *** *** ****** *** 0 0 E14.5 E16.5 E18.5 P1 Adult E14.5 E16.5 E18.5 P1 Adult f g3 1.5 h 1.0 *** ns ** 2 1.0 ** 0.5 1 * 0.5 ** 0 0 0 E14.5 E16.5 E18.5 E14.5 E16.5 E18.5 E14.5 E16.5 E18.5 Fig. 2 Primary cilia disassemble during mouse RPE development. matures (c). Gene expression as measured by quantitative real-time Quantification of ciliation in mouse RPE at E16.5, post-natal day PCR from isolated primary mouse RPE cells show altered expression 1 (P1) and adult show that the number of ciliated cells drastically of ciliary (Arl13b and Ift88) and ciliary disassembly markers (Hef1, decreased after birth (a). Transmission electron micrographs of basal AurA and Hdac6) (d–h). Fold changes and significance were calcu- bodies or ciliary axoneme profiles (marked by red asterisks) of adult lated relative to E16.5. Values represent data from three or more inde- mouse RPE (b). Schematics show classification of ciliary structures pendent animals (biological repeats) each with three technical repeats into different classes (I, II and III), depending on the absence (class per data set. Statistics were done using the Dunnett’s multiple com- I) or presence of a membranous attachment (the ciliary vesicle) (class parison test *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001; ns not significant. II) or ciliary axoneme (class III). Quantification of class I-III pro- Scale bars: 2 µm files shows that the number of class III profiles decrease as the RPE 1 3 Hef1 fold change Arl13b fold change Ciliated cells [%] AurA fold change Ift88 fold change Hdac6 fold change Bardet–Biedl Syndrome proteins regulate cilia disassembly during tissue maturation 761 tissue matured (Fig. 2d, e). Because ciliary retraction in the and benchmark for RPE maturation and their disruption can RPE may be actively controlled via ciliary disassembly, we contribute to aberrant epithelial morphology. We observed also analyzed the gene expression of Hef1, AurA and Hdac6 a downregulation of Cdh1, Ocln, Rab27a and Myo7a as [22, 43, 44], which are known regulators of ciliary disassem- quantified by qRT-PCR (Supp. Figure 3c). Bbs8 knockout bly. Expression of ciliary disassembly components changed (Bbs8−/−) embryos also showed reduced number of ciliated dynamically as the cilium retracted (Fig. 2f–h). Hef1 expres- RPE cells at E16.5 compared to that of WT (Fig. 3e, f, Supp. sion increased gradually from E14.5 to E18.5. Expression Figure 3c) although less significant changes in gene expres- of AurA and Hdac6 was decreased by ~ 50% between E16.5 sion were observed. and E18.5. This suggests that AurA and Hdac6 expressions To further elucidate the mechanisms by which BBS mol- are highest just before ciliary disassembly is observed and ecules regulate ciliary disassembly, we utilized an in vitro decline by E18.5, at which point the majority of cilia have culture system by knocking down (KD) BBS8 or BBS6 disassembled. using short interfering RNA (siRNA) in hTERT-RPE1 Taken together, these data demonstrate that the primary cells. This cell line has previously been used to characterize cilium is disassembled upon maturation of the RPE. Tem- ciliary disassembly and is derived from human RPE tissue. poral and spatial patterning of ciliation across the RPE Knockdown was validated by RT-qPCR and Western blot- matches the known mechanism of maturation for this tis- ting (Supp. Figure 4a–d). Cells were serum-starved to induce sue. The present data and our previous work [19] support ciliogenesis. Similar to the in vivo mouse RPE, we observed the hypothesis that the transient expression of the primary fewer ciliated cells upon BBS8 and BBS6 KD (24.9 ± 11.6 cilium is required for RPE maturation, which occurs in an and 24.1 ± 9.62%) compared to the non-targeting siRNA organized pattern. To further understand the mechanism of control (NTC, 74.7 ± 9.77%) (Fig. 3g, h). In the remaining ciliary disassembly, we next sought to investigate how cili- cells that retained cilia, cilia length was also significantly ary proteins contribute to the process of ciliary disassembly. reduced compared to NTC (NTC: 3.58 μm, BBS8 KD: 2.26 μm, BBS6 KD: 2.62 μm) (Fig. 3i). Loss of BBS proteins affects ciliated RPE We focused on Bardet–Biedl syndrome (BBS) proteins Interaction of BBS proteins with mediators of ciliary in view of our prior observation that BBS proteins regu- disassembly late primary cilia length and ciliary trafficking [27]. BBS6 (MKKS) is a component of the BBS chaperonin complex Next, we sought to identify whether additional BBS pro- thought to be required for BBSome assembly. BBS8 (TTC8) teins interact with Inversin, a protein known to be involved is a component of the BBSome complex required for ciliary in AurA mediated ciliary disassembly [35]. Since we had trafficking. We observed that RPE tissue from Bbs6 knock- previously shown that BBS8 directly interacts with Inver- out (Bbs6−/−) mouse embryos displayed fewer ciliated cells sin during regulation of Wnt signaling in development of at E16.5. The knockout cilia were shorter (0.87 ± 0.67 µm) the RPE [19], we wanted to see if this interaction extended compared to WT (2.25 ± 0.94 µm) littermates (Fig. 3a–d). In to other BBS proteins. Using GFP-traps, we were able to addition to changes in cilia length, we also observed changes pull down overexpressed BBS6-myc and BBS2-myc with in cell size in Bbs6 knockout mouse embryos. In WT, we Inversin-eGFP in HEK293T cells (Fig. 4a, b). To confirm saw little variation in cell size between neighboring cells. the physical interaction between Inversin and BBS6 in situ, However, in Bbs6−/− we observed an increase in average cell a proximity ligation assay (PLA) was performed using anti- size and broader distribution of cell size (Fig. 3a; Supp. Fig- bodies against endogenous Inversin and overexpressed myc- ure 3a, b). This abnormal patterning reflects disrupted RPE BBS6. Positive PLA events shown as distinct fluorescent maturation as we had seen for Bbs8−/− in our previous paper foci confirmed the interaction (Fig. 4c). [19]. Abnormal patterning is possibly a consequence of dys- In an immortalized murine kidney medullary (KM) cell regulation of cell junction components such as Occludin and line, Inversin is localized to the base of the cilium as seen Epithelial Cadherin (Cadherin 1). Occludin is an integral by Inversin co-localization with acetylated α-tubulin in the membrane protein found at tight junctions [45], and Epithe- majority of ciliated cells (Fig. 4d, e). These cells were used lial Cadherin [46] is a major component of adherens junc- as endogenous Inversin is better detectable in these cells tions, both of which are essential for the regulation of RPE upon immunocytochemistry. Furthermore, the Wnt signaling intercellular junction integrity and function, and apical basal and ciliary phenotype are recapitulated in these cells [27]. polarity. Ras-related protein Rab-27A (Rab27) and Myosin In KM cells derived from Bbs6 knockout (Bbs6−/−) mice, VIIA (Myo7a) are both required for melanosome transport significantly fewer cilia showed Inversin localization at the in the RPE, dysfunction of which leads to defective visual base, and Inversin expression was more dispersed through- cycle [47]. Expression of these genes is seen as a marker out the cytoplasm (Fig. 4d, f). Combined these data suggest 1 3 7 62 S. R. Patnaik et al. Fig. 3 Absence of BBS proteins a +/+ -/- b decreases RPE ciliation in vivo Bbs6 Bbs6 80 and in vitro. Representative immunofluorescence images of 60 E16.5 mouse RPE flatmounts from wildtype and Bbs6−/− * 40 littermates, labeled with * *** antibodies against the primary 20 cilium (Arl13b; red, acety- lated α-tubulin (Ac. tubulin); cyan) and cell junctions (Zona Arl13b ZO1 Arl13b ZO1 * 0 +/+ -/- Occludens (ZO-1); green) (a, Bbs6 Bbs6 c). Boxplots of ciliation (b) c d and cilia length (d) show a significant decrease in cilia 4 number and cilia length in Bbs6 knockout animals. Repre- 3 sentative immunofluorescence Ac. tubulin Arl13b Merge images of E16.5 mouse RPE flatmounts from wildtype and 2 *** Bbs8−/− littermates, labeled with antibodies against Arl13b; 1 red and ZO-1; green show a reduced number of ciliated cells 0 in Bbs8 knockout mice (e). Box- Ac. tubulin Arl13b Merge Bbs6+/+ Bbs6-/- plots confirmed the significant reduction of ciliated cells in e Bbs8+/+ Bbs8-/- f 100 Bbs8 knockout RPE (f). Repre- sentative immunofluorescence 80 images of primary cilia labeled * *** with antibodies against Arl13b; * 60 green and polyglutamylated 40 tubulin (GT335); red in BBS8 * and BBS6 KD hTERT-RPE1 20 compared to non-targeting 0 control (NTC) (g). Graphical Arl13bZO1 Arl13b ZO1 * Bbs8+/+ Bbs8-/- representation of percentage of ciliated cells (NTC n = 250, g NTC BBS8 KD BBS6 KD h BBS8 KD n = 150 and BBS6 100 KD n = 200) (h) and cilia length (i) of control in comparison to 80 KD cells. White asterisks (*) label cells lacking cilia. Three 60 or more individual animals were used per sample set. Statisti- 40 *** *** cal analyses in b, d and f were performed using two-tailed 20 Mann–Whitney U test, where 0 ***p < 0.001. For d n = 40 cells NTC BBS8 BBS6 per genotype. Statistical analy- KD KD ses in h and i were done using GT335 GT335 GT335 i the Dunnett’s multiple com- 8 parison test ***p ≤ 0.001. Scale bars: a, e 10 µm; b 2 µm; g 10 µm, magnified images 5 µm. 6 *** KD Knockdown *** Arl13b Arl13b Arl13b 4 2 0 Merge Merge Merge NTC BBS8 BBS6 KD KD 1 3 Bbs6-/- Bbs6+/+ Cilia length [µm] Ciliated cells [%] Ciliated cells [%] Cilia length [µm] Ciliated cells [%] Bardet–Biedl Syndrome proteins regulate cilia disassembly during tissue maturation 763 Fig. 4 Mislocalization of a Inversin upon loss of BBS BBS6-myc + - + b proteins. HEK293T cells Inversin-GFP + + - BBS2-myc + + transiently co-transfected empty-myc - + - Inversin-GFP + - with myc-tagged BBS and empty-GFP - - + empty-GFPInversin-GFP plasmids. Cell - + lysates subjected to GFP-TRAP BBS6-myc 55 BBS2-myc 100 pulldown followed by Western 1 0.01 blotting show that Inversin-GFP Input-myc 55 Input-myc 100 interacts with myc-tagged BBS6 (a) and myc-tagged BBS2 (b). Inversin-GFP 130 Inversin-GFP 130 Proximity ligation assays (PLA) 100 100 of HEK cells overexpressing myc-BBS6 were performed using antibodies against myc Input-GFP 55 Input-GFP 55 and endogenous Inversin. 40 40 Positive PLA foci (green) 35 indicate interaction between empty-GFP empty-GFP 35 Inversin and BBS6. Empty-myc transfected control cells did not display positive PLA foci. c myc-Inversin PLA F-actin merge TRITC-Phalloidin (F-actin, red) was used to visualize cell outlines (c). Representative immunofluorescence images of kidney medullary (KM) cells labeled with antibodies against the primary cilium (acetylated α-tubulin (Ac. tubulin); red) and Inversin (green) show dimin- ished localization of Inversin to the base of the cilium in Bbs6−/− cells as compared to the wildtype control (d). ROI linear profile represents fluorescence intensity of corresponding cyan line on the merged image. Peaks indicated by asterisk represent area of co-localization of Inversin and Ac. tubulin in wildtype KM cells (e). Bbs6+/+ d Inversin Ac. tubulin merge e n = 215 cilia, Bbs6−/− n = 140 1.0 * Ac. tubulin cilia. Boxplots show a reduc- Inversin tion in percentage of Inversin positive Ac. tubulin in Bbs6−/− KM cells compared to control 0.5 cells (f). Statistical analyses in e were performed from three independent experiments using two-tailed Mann–Whitney U test, where ***p < 0.001. Scale 0.0 .00 .56 .11 .67 .22 8 4 9 5 1bars: c, d 10 µm 0 0 1 1 2 2.7 3.3 3.8 4.4 5.0 f ROI [µm] 100 80 *** 60 40 20 0 Bbs6+/+ Bbs6-/- 1 3 magnified Bbs6-/- magnified Bbs6+/+ empty-myc BBS6-myc Inversin positive cilia [%] Intensity (A.U.) 764 S. R. Patnaik et al. a b KD c 2.0 ** NTC BBS8 BBS6 * 1.5 * HDAC6 160kDa HDAC6 1.0 * GAPDH 0.537kDa * 0.0 AurA d NTC BBS8 BBS6 ** pAurA KD KD48kDa e 2.0 ns AurA * HEF1 GAPDH 37kDa 1.5 ns pAurA * 1.0 AurA 48kDa 0 5 10 0.5 * Fold change **GAPDH 37kDa 0.0 NTC BBS8 BBS6 f g KD KD 105 NTC BBS8 KD BBS6 KD 150 Quantification 104 3 10010 102 50 101 ** ** 50 100150 200250 50 100150 200250 50 100150 200250 0 NTC BBS8 BBS6 FSC-A FSC-A FSC-A h 24h SS + 5h treatment i 24h SS + 5h treatment j 24h SS + 5h treatment NTC BBS8 KD NTC BBS8 KD NTC BBS8 KD BBS6 KD MG132 - + - + MG132 - + - + Tubacin - + - + - + AurA HDAC6 HEF1 (48kDa) (160kDa) (~110kDa) Ac. tubulin (55kDa) GAPDH GAPDH (37kDa) (37kDa) GAPDH(37kDa) FC 1 3.7 0.1 0.8 FC 1 1.7 0.4 0.7 FC 1 0.8 1.2 0.8 1.2 0.7 x 3.7 4 2.0 x 1.7 1.5 x 0.67 x 0.58 x 0.8 3 1.5 1.0 2 1.0 x 1.75 1 x 8 0.5 0.5 0 0.0 0.0 MG132 - + - + MG132 - + - + Tubacin - + - + - + NTC BBS8 KD NTC BBS8 KD NTC BBS8 KD BBS8 KD that BBS6 and BBBS2 proteins interact with Inversin and and subsequent destabilization of ciliary tubulin [22, 48]. regulate its expression at the ciliary base. We wanted to determine whether BBS proteins are involved in cilia maintenance by protecting the cilium against AurA- BBS proteins regulate key mediators of primary HDAC6-mediated disassembly. Gene expression analysis ciliary disassembly showed an increase of ciliary disassembly genes HDAC6 and HEF1 upon knockdown (KD) of BBS8 or BBS6, con- In mammalian cells, ciliary disassembly is mediated by sistent with reduced ciliary length (Figs. 3 g–i; 5a). Western recruitment of HEF1 at the basal body, leading to down- blot analysis also showed elevated levels of HDAC6 protein stream phosphorylation and activation of AurA and HDAC6, expression in hTERT-RPE1 cells (Fig. 5b, c). Expression of 1 3 Hef1 / GAPDH Rel. density (A.U.) AurA: AF488 AurA / GAPDH Rel. density (A.U.) HDAC6 GAPDH AurA/pAurA / GAPDH HDAC6 / GAPDH Rel. density (A.U.) Relative density (A.U.) Relative density (A.U.) AurA positive cells [%] Bardet–Biedl Syndrome proteins regulate cilia disassembly during tissue maturation 765 ◂Fig. 5 BBS proteins regulate key mediators of cilia disassembly. Although HEF1 mRNA expression levels were elevated Quantitative real-time PCR shows increased gene expression of cilia in vitro and in vivo, Western blot analysis showed a reduc- disassembly components (HEF1 and HDAC6) and decreased expres- sion of AurA relative to non-targeting control (NTC, red line) in tion in protein upon loss of BBS8 (Supp. Figure 5b). We serum-starved BBS8 or BBS6 knockdown (KD) hTERT-RPE1 cells. hypothesized that in the absence of BBS8, HEF1 is actively GAPDH was used as housekeeping control (a). Western blots show phosphorylated and targeted for proteasomal degradation. To a significant increase in protein levels of HDAC6 upon KD of BBS8 test this, we treated serum-starved cells with the proteasome and BBS6 in serum-starved hTERT-RPE1 cells (b, c). Conversely, AurA protein levels were decreased upon KD of BBS8 and BBS6 inhibitor MG132. This resulted in ~ 8-fold recovery of HEF1 in serum-starved hTERT-RPE1 cells, although pAurA levels were expression in treated KD cells compared to untreated KD retained (d, e) suggesting an increased ratio of active over total AurA. cells which only had a 3.7-fold recovery (Fig. 5h). Therefore, Flow cytometry analysis was used to further quantify AurA expres- over 50% more HEF1 was recovered in KD cells compared sion in serum-starved BBS8 and BBS6 KD hTERT-RPE1 cells (f, g). Representative flow cytometry dot plots show the AurA-positive cell to control (0.1–0.8 vs 1–3.7). Although we saw a mild recov- population (P3, blue) and AurA-negative cell population (P2, red) ery of total AurA upon inhibiting proteasomal activity in (f). Quantification of the AurA-positive cell population confirmed these cells (Fig. 5i), there was little difference between KD a significant decrease in the BBS8 and BBS6 KD cells compared to and control. Based on these observations, we propose that NTC (g). Western blots show that KD of BBS8 in hTERT-RPE1 cells leads to decreased level of HEF1, which was partially restored by ciliary disassembly components are differentially regulated treatment with proteasome inhibitor MG132 (h). An 8-fold increase by BBS proteins. While loss of BBS8 results in increased in HEF1 protein expression was observed upon BBS8 KD compared levels of HDAC6, it also results in the proteasomal degra- to 3.7-fold in NTC. Decreased protein levels of AurA in BBS8 KD dation of HEF1 and to some extent of AurA. We wanted to hTERT-RPE1 cells were also partially restored by treatment with proteasome inhibitor MG132 (i). Increased levels of HDAC6 in further elucidate whether the ciliary length defect observed BBS8 KD hTERT-RPE1 cells were concomitant with an increase in in BBS deficient cells could be attributed to dysfunction of acetylated α-tubulin and were reduced upon treatment with HDAC6 ciliary disassembly components. inhibitor tubacin, as quantified by Western blot (j). Quantification of Western blot data was normalized to GAPDH levels. Bar charts show relative protein expression in arbitrary units (AU). Data are expressed Ciliary disassembly component inhibition rescues as mean ± SD, n = 3 separate experiments for (a-g), while n = 2 for the ciliary length defect caused by BBS knockdown h-j. Statistical analyses in c, g were done using the Dunnett’s multi- ple comparison test and e using Shidak’s multiple comparison test. In To confirm that ciliary defects upon BBS KD can be attrib- c, e and g *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001; ns not significant. KD Knockdown, NTC non-targeting control, SS serum-starved, FC fold uted in part to an increase in HDAC6 expression, we treated change, FSC-A forward scatter area serum-starved NTC and BBS KD cells with tubacin, a spe- cific HDAC6 inhibitor [22, 49]. Tubacin treatment caused a decrease in HDAC6 and a concomitant increase in the total AurA mRNA and AurA protein was decreased in KD protein level of acetylated tubulin in both NTC and KD cells cells, as analyzed by qPCR, Western blot and flow cytometry compared to the vehicle (DMSO) alone, as seen by Western (Fig. 5a, d, e, f, g). In contrast, the level of active phospho- blot (Fig. 5j). This corresponded to a rescue in cilia length rylated AurA (pAurA) was unchanged as shown by Western (Fig. 6a, b). A significant change in the number of ciliated blot with an antibody specific for pAurA (Thr288) (Fig. 5d, cells was not observed after treatment with tubacin (Fig. 6c). e). Therefore, the ratio of pAurA/AurA was elevated in the Next, we used a potent and selective inhibitor of AurA, KD cells compared to control even without ciliary disas- AurA Inhibitor I [35, 50]. Similarly, this also ameliorated sembly via serum activation. Previous reports showed that the cilia length defect in BBS8- and BBS6-deficient cells levels of pAurA peak when cilia disassemble [23]. When we (Fig. 6d, e). To test whether HEF1 activity also underlies the do combined serum activation with BBS KD, we observed AurA and HDAC6 mediated ciliary disassembly in BBS KD a similar trend in that active pAurA is retained upon BBS8 cells, we performed double KD experiments. We observed or BBS6 KD (Supp. Figure 5a). As quantified by qPCR, an appreciable rescue in cilia length in the BBS and HEF1 HEF1 transcript expression was elevated upon both BBS8 double KD cells compared to single KD (Fig. 6f, g). We and BBS6 KD (Fig. 5a). In an attempt to verify these data confirmed that double KD did not lead to loss of individual in vivo, we analyzed mRNA expression of Hef1, AurA and gene KD efficiency (Supp. Figure 4e–g). Recovery of cilia Hdac6 in knockout mouse tissue using unpurified RPE (RPE length after inhibition or KD of HEF1, AurA and HDAC6 and choroid). Expression of ciliary disassembly genes Hef1 supports our hypothesis that BBS proteins are involved in and Hdac6 was increased in Bbs8−/− relative to wildtype the control of ciliary disassembly (Fig. 6h). control littermate tissue. No significant change in expres- To address off-target effects of siRNA we knocked sion level could be seen for AurA. In Bbs6−/− mice, Hef1 down BBS8 from hTERT-RPE1 cells using single (siRNA was significantly increased, AurA significantly decreased and 1 or siRNA2) and double siRNAs (siRNA 1 + 2) and looked Hdac6 remained unchanged (Supp. Figure 3d). These gene for levels of HDAC6 via Western blotting. We observed a expression patterns show a similar trend to the in vitro data. similar increase in HDAC6 levels in single vs double KD 1 3 766 S. R. Patnaik et al. a 2+ 4h SS ± Tubacin (5h +treatment) + b - - - 8 ns NTC NTC BBS8 KD BBS8 KD BBS6 KD BBS6 KD 6 ** * 4 10µm 2 0 Tubacin - + - + - + NTC BBS8 KD BBS6 KD c ns 100 ns 80 ns 60 40 20 0 Tubacin - + - + - + NTC BBS8 KD BBS6 KD d 24h SS ± AurA inhibitor I (5h treatment) e 8 *** ***x 1.19 x 1.60 - + - + - + NTC NTC BBS8 KD BBS8 KD BBS6 KD BBS6 KD 6 ***x 1.30 4 2 0 AurA inhibitor - + - + - + NTC BBS8 KD BBS6 KD g 12 ***x 2.13 10 ***x 1.4 8 6 4 2 0 Hef1 KD - + - + - + NTC BBS8 KD BBS6 KD f BBS8 + BBS6 + h NTC HEF1 KD BBS8 KD HEF1 KD BBS6 KD HEF1 KD rescue cilia BBS length KD HDAC6 HEF1 AuroraA Tubacin siRNA AurA inhibitor I cells, as quantified using Western blotting analysis (Supp. same effect on AurA expression levels (Supp. Figure 5a). Figure 5c). Furthermore, using different combinations of Therefore, we believe that the phenotype we observe is siRNA against BBS8 from different companies had the specific. To rule out differences in cell cycle stages, which 1 3 Merge Arl13b Ac. Tubulin Merge Arl13b Ac. Tubulin Merge Arl13b Ac. Tubulin Cilia length [µm] Cilia length [µm] Ciliated cells [%] Cilia length [µm] Bardet–Biedl Syndrome proteins regulate cilia disassembly during tissue maturation 767 ◂Fig. 6 Inhibition of ciliary disassembly components rescues BBS this, the level of acetylated β-catenin (Lys49) was reduced mediated ciliary disassembly. Representative immunofluorescence after BBS8 or BBS6 KD in hTERT-RPE1 cells as quantified images of cilia stained with antibodies against acetylated α-tubulin (Ac.tubulin, red) and Arl13b (green), from non-targeting control by Western blotting (Fig. 7a). We also sought to identify (NTC), BBS8 and BBS6 knockdown (KD) hTERT-RPE1 cells further downstream phosphorylation events of β-catenin treated with and without HDAC6 inhibitor, tubacin (a). Quantifica- that lead to degradation. Using phospho-specific antibodies, tion of ciliary length show that tubacin treatment did not affect cili- we detected a decrease in phosphorylation at T41/S45 and ary length in control, yet was able to increase ciliary length in BBS8 and BBS6 KD cells (b). Quantification of ciliated cells showed that S33/37/T41 as a result of BBS8 and BBS6 KD (Fig. 7b, c). treatment with tubacin had no effect on ciliation (c). Treatment with To strengthen our findings on Western blot, we performed AurA inhibitor I was also able to significantly increase ciliary length immunocytochemistry using an antibody against acetylated in BBS8 and BBS6 KD cells. BBS8 and BBS6 KD tubacin-treated β-catenin (Lys49) and observed a reduction in nuclear fluo- cells show a greater increase in cilia length in comparison to their DMSO mock-treated counterparts, while control cells showed mini- rescence intensity upon BBS KD. Treatment with HDAC6 mal increase (d, e). KD of HEF1 increased ciliary length in control inhibitor tubacin rescued the levels of acetylated β-catenin hTERT-RPE1 cells. Double KD of HEF1 and BBS8 or BBS6 was K49 in BBS-deficient cells (Fig. 7d, e). Previous studies able to reverse the ciliary disassembly phenotype observed in BBS8 showed that phospho-(S33/37/T41)-β-catenin localizes to or BBS6 KD (f, g). A model showing the inhibition or KD of cili- ary disassembly components causes rescue of cilia length in BBS the base of the cilium [51, 53]. We observed localization of KD hTERT-RPE1 cells (h). Statistical analyses in b, c, e, g were phospho-(S33/37/T41)-β-catenin not only to the basal body, done using the Sidak’s multiple comparison test from two independ- but also in the nucleus (Fig. 7f). Upon KD of BBS8 and ent experiments. The length of at least 1000 cilia from the six dif- BBS6, this nuclear localization is diminished while localiza- ferent treatment groups (NTC treated, untreated, BBS8/6 KD treated, untreated) in each experiment (Tubacin treatment, AurA treatment tion at the basal body is often absent (Fig. 7f, g). and Hef1 KD) were measured. *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001; Reduction of phosphorylation at S33/37/T41 ultimately ns not significant. KD Knockdown, NTC non-targeting control, SS results in reduced degradation and consequent increase in serum-starved levels of total β-catenin as observed in Western blot (Fig. 7h, i). This increased level of total β-catenin translated to could affect changes in ciliary disassembly components, we increased levels of β-catenin activity as measured via lucif- performed cell cycle analysis via fluorescence-activated cell erase assays (Fig. 7j). Stimulation with Wnt3a conditioned sorting (FACS) using propidium iodide (PI). This corrobo- medium significantly increased β-catenin driven TCF/LEF rated that the majority of cells remained in G0/G1 phase in transcription after BBS8 or BBS6 KD. In contrast to phos- both NTC and KD cells (Supp. Figure 5d), confirming that phorylation at S33/37/T41, phosphorylation at S552 causes our results were cell cycle independent. stabilization and nuclear accumulation of β-catenin [54]. Consistent with this, and the increased activity of β-catenin, Loss of BBS proteins regulate HDAC6, thereby we detected elevated expression and nuclear accumulation influencing post‑translational modification of pS552 β-catenin in nonciliated BBS8 KD cells (Fig. 7k, of β‑catenin l). Together, these experiments show that loss of BBS mole- cules influences post-translational modification of β-catenin, Previous studies have shown that ciliogenesis and ciliary which ultimately regulates its signaling activity. disassembly modulate the switch from β-catenin-dependent canonical to non-canonical Wnt signaling pathways [36, 51]. Therefore, we examined the impact of BBS-regulated ciliary Discussion disassembly components on Wnt signaling. β-catenin is a direct substrate of HDAC6, which deacetylates β-catenin at In the present work, we demonstrate that ciliary traffick- lysine residue (K49), inhibiting downstream phosphoryla- ing proteins are required for homeostasis of primary cili- tion [52]. This results in β-catenin stabilization and nuclear ary disassembly components, specific regulation of which accumulation. Although we and others have shown that sup- is required for ciliary retraction and regulation of signal- pression of BBS genes results in stabilization of β-catenin ing pathways. Precise regulation of ciliation is an absolute and altered regulation of downstream Wnt targets [18, 38], requirement for tissue differentiation [8, 55]. We focused our the mechanisms that cause this stabilization are not yet attention on BBS proteins known to be required for ciliary known. Loss of BBS is not thought to directly affect the trafficking, in particular on a component of the Bbsome, core activity of the proteasome [38], which suggests a defect BBS8, and a component of the chaperonin complex, BBS6, in phosphorylation and subsequent targeting of β-catenin thought to be required for Bbsome assembly [55–58]. for degradation. Since the stability of β-catenin is mediated The RPE is a ciliated epithelial monolayer essential for by various specific phosphorylation and acetylation events visual function. Insights into RPE maturation can be extrap- at different sites, we hypothesized that upon loss of BBS, olated to other epithelial tissues for example lung epithelial β-catenin becomes differentially modified. Consistent with cells [19]. In mice we showed that as the RPE matures, the 1 3 768 S. R. Patnaik et al. a BBS8 BBS6 b BBS8 BBS6 c BBS8 BBS6 NTC KD KD NTC KD KD NTC KD KD acetyl β- β-catenin β-catenin catenin K49 92kDa pT41/S45 92kDa pS33/37/T41 92kDa GAPDH 37kDa GAPDH 37kDa GAPDH 37kDa 1.0 1.0 1.0 0.8 * 0.8 0.8 ** **0.6 0.6 *** 0.6 ** 0.4 0.4 0.4 0.2 0.2 0.2 0.0 0.0 0.0 NTC BBS8 KD BBS6 KD NTC BBS8 KD BBS6 KD NTC BBS8 KD BBS6 KD d acetyl f Ac. tubulin β-catenin β-catenin K49 Merge Merge + PCNT2 pS33/37/T41 Merge g 100 *** 50 *** 0 NTC BBS8 BBS6 KD KD h iBBS8 BBS6 NTC KD KD 2.0 * total β-catenin 92kDa 1.5 * 1.0 GAPDH 37kDa j 0.5 150 0.0 ** NTC BBS8 BBS6 100 KD KD * l NTC BBS8 KD 50 0 Wnt3a - + - + - + k NTC BBS8 KD BBS6 KD e 60 *** 20 ns *** 15 *** 40 10 ns 5 20 0 NTC BBS8 NTC BBS8 0 Tubacin - + - + - + KD KD NTC BBS8 BBS6 Non ciliated Ciliated KD KD Serum starved 1 3 Nuclear acetylated BBS6 KD + BBS8 KD + acetyl. ß-catenin K49/GAPDH ββ-Catenin K49 Tubacin BBS6 KD Tubacin BBS8 KD NTC + Tubacin NTC Relative density (A.U.) intensity (A.U.) Nuclear pβ-Catenin S552 Relative Luciferase BBS6 KD BBS8 KD NTC ß-catenin pT41/S45 / GAPDH intensity (A.U.) activity Relative density (A.U.) Merge pβ-catenin S552 Ac. tubulin Total ß-catenin / GAPDH Relative density (A.U.) ß-catenin pS33/37/T41 / GAPDHRelative density (A.U.) β-catenin pS33/37/T41 positive basal bodies [%] Bardet–Biedl Syndrome proteins regulate cilia disassembly during tissue maturation 769 ◂Fig. 7 BBS-mediated regulation of ciliary disassembly components The most common pathways that govern ciliary disassem- alters post-translational modification of β-catenin. Western blot analy- bly are through AurA, HEF1 and HDAC6 [10, 22]. Previous sis and quantification show reduced acetylation of β-catenin at K49 (a) and consequently reduced phosphorylation at p41/44 (b) and reports have shown that BBS proteins regulate cilia length p33/37/41 (c) upon BBS8 and BBS6 knockdown (KD) in hTERT- [27] and that BBIP10 (BBS18), an additional subunit of the RPE1 cells, suggesting an increase in stable and active β-catenin. BBSome, interacts directly with HDAC6 [37], yet the molec- Immunocytochemistry and quantification using an antibody against ular mechanisms underlying this phenomenon have not been acetylated β-catenin K49 (green) show reduced expression in the nucleus upon BBS8 and BBS6 KD compared to non-targeting control elucidated. Here, we observed that the loss of BBS proteins (NTC) in hTERT-RPE1 cells (d). Cells were co-labeled with Arl13b resulted in increased levels of HDAC6 and that inhibition of (red) to confirm reduction in ciliary length. Reduced β-catenin K49 HDAC6 resulted in a rescue of cilia length in BBS KD cells. expression could be rescued by treatment with HDAC6 inhibi- Similarly, inhibition of AurA and HEF1 also resulted in res- tor tubacin (n ≥ 100 for each group) (d, e). Immunocytochemistry using an antibody against β-catenin pS33/37/T41 (green), a target of cue of cilia length. Therefore, we propose that BBS proteins β-catenin acetylation, shows expression at the base of the cilium and maintain cilia length by suppressing HEF1-AurA-HDAC6- in the nucleus in NTC hTERT-RPE1 cells (f, g). Ciliary axoneme is mediated disassembly (Fig. 8). Although the total levels of marked by acetylated α-tubulin (Ac. tubulin, red), and the basal body pAurA were not changed upon BBS KD, since inhibition of by Pericentrin 2 (PCNT2, magenta). Quantification confirms reduced localization of β-catenin pS33/37/T41 at the basal body upon BBS8 AurA activity rescued the ciliary length defect in these cells, and BBS6 KD (g). BBS8 and BBS6 KD cause less β-catenin deg- this suggests a difference in activity. radation, resulting in increased levels of total β-catenin in hTERT- Because Inversin (NPHP2), a key ciliary protein, influ- RPE1 cells, as quantified from Western blot (h, i). This was con- ences ciliary disassembly via inhibiting AurA [35, 36] firmed by a TCF/LEF luciferase activity assay that measures the transcriptional activity of β-catenin enzymatically. Luciferase activity and is also a key mediator of Wnt signaling, we postulated in Wnt3a-treated non-targeting control HEK cells is upregulated com- that the role of BBS proteins in ciliary disassembly may pared to the untreated control. The Wnt response (luciferase activity) in part be mediated via Inversin. We show that BBS pro- is significantly enhanced upon the suppression of BBS8 and BBS6 teins are required for Inversin protein expression at the (j). Immunofluorescence analysis and quantification show increased stability and nuclear translocation of active β-catenin pS552 (green) base of the cilium, thereby regulating AurA phosphoryla- in non-ciliated hTERT-RPE1 cells after BBS8 KD (n = 263 for NTC tion and subsequent ciliary disassembly. AurA can also be and 100 for BBS8 KD) (k, l). Cells were co-labeled with Ac. tubulin activated by other proteins such as Pitchfork, calmodulin, (green) to confirm reduction in ciliary length. Quantification of West- trichoplein, HIF1α (Hypoxia-inducible factor 1-alpha) or ern blot data was normalized to GAPDH levels. Bar charts in a–c show relative protein expression in arbitrary units (A.U.). Data in a, Plk1(Polo-like-Kinase 1) [60]. Moreover, some kinesins b, c, i, j are expressed as mean ± SD, n = 3 separate experiments. Data such as Kif2a (Kinesin family member 2a) might also be in g show mean ± SD, two independent experiments. Statistical analy- involved as they are direct targets of AurA [61]. Therefore, ses in a, b, c, g, i were done using the Dunnett’s multiple comparison BBS proteins could also be acting upon these regulators. In test. Data analyses in e, j, k were performed using Sidak’s multiple comparison test. p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001; ns not signifi- support of this, some of these proteins have already been cant. Scale bars: a, e 10 µm; b 2 µm; h 5 µm shown to interact with other ciliary proteins [62, 63]. BBS proteins may also influence other ciliary length regulating components such as CPAP (Centrobin-mediated Regulation primary cilium retracts with only a few stunted cilia being of the Centrosomal Protein 4.1-associated Protein), Nde1 retained after birth. Cilia dysfunction in knockout mice (Nuclear distribution protein nudE homolog 1) and OFD1 resulted in abnormal RPE patterning in part due to defec- (oral–facial–digital syndrome 1) proteins [64], which remain tive RPE maturation (this and previous study) [19]. Retrac- to be addressed. tion of the primary cilium is accompanied by expression of Previous studies showed that BBS proteins interact with ciliary disassembly components suggesting that loss of the proteasomal subunits regulating the composition of the cen- primary cilium is a tightly controlled cellular event. Inter- trosomal proteasome [38, 65]. Consequently, loss of BBS estingly, such mechanisms of ciliary disassembly are also proteins results in altered signal transduction due to defects observed in other tissues, such as in the auditory hair cells in proteasomal clearance of key signaling proteins includ- of the inner ear [6]. Here, the kinocilium plays an impor- ing β-catenin [38, 65]. Here, we show that the loss of BBS tant role during development of the Organ of Corti but is proteins decreases the stability of HEF1 and AurA proteins. reabsorbed by post-natal day 10 [59]. Because cilia are not A partial recovery of these proteins is observed upon inhibit- retained, we suggest that they are less likely to be essential ing proteasomal function using MG132, suggesting that BBS for cellular function in adult RPE, but more likely required proteins protect Hef1 and AurA from proteasomal degrada- for regulating signaling processes during development as tion and thus inhibit ciliary dissasembly. Increased stability we have recently demonstrated [19]. Since retraction of the of β-catenin (discussed below) and subsequent upregula- primary cilium in the RPE is accompanied by the expression tion of canonical Wnt signaling upon BBS KD may also of ciliary disassembly components in vivo, we focused our in part be ascribable to defects in proteasomal clearance. attention on the molecular control of these processes. Similarly, the cilia protein RPGRIP1L (RPGR-Interacting 1 3 770 S. R. Patnaik et al. HDAC6 P HDAC6 AuroraA HDAC6 AuroraA BBS6 Inversin HEF1 BBS6 Inversin HEF1 β-Catenin BBS8 BBS8 β-Catenin β-Catenin P P PP P P P P activate β-Catenin target genes ciliary proteins P phosphoryl group ciliary disassembly proteins acetyl group Wnt-regulator proteasome Fig. 8 Model of BBS-mediated regulation of ciliary disassembly. the cilium. This leads to phosphorylation and activation of AurA via BBS proteins interact with Inversin and regulate its expression at HEF1, resulting in upregulation and activation of HDAC6. HDAC6 the base of the cilium. Inversin inhibits HEF1/AurA, inactivating deacetylates β-catenin, hence preventing further phosphorylation and histone deacetylase HDAC6 thus preventing ciliary disassembly. As degradation. Consequently, β-catenin is stabilized and translocates to a consequence of dormant HDAC6, β-catenin remains acetylated the nucleus activating canonical Wnt signaling. This also regulates and phosphorylated, thereby undergoing proteasomal degradation. ciliary length Upon BBS suppression, Inversin expression decreases at the base of Protein 1-Like) has been shown to protect canonical Wnt as ubiquitination, phosphorylation, acetylation and gluta- components (dishevelled) from proteasomal degradation at mylation in various signaling processes [67]. PTMs such the basal body [53, 66]. Because HEF1 stabilization differed as phosphorylation also actively influence the process of in BBS8 compared to BBS6 KD cells, it suggests differ- ciliogenesis and maintenance [68]. Targeting β-catenin for ences in the functional role of the BBSome vs. the BBS degradation is a complex process involving PTMs at vari- chaperonins. One explanation for reduced protein levels of ous sites [41]. HDAC6 deacetylation of β-catenin at K49 HEF1 in serum-starved BBS8 KD cells could be a feedback inhibits downstream phosphorylation. Because HDAC6 loop mechanism. Since it is clear from our experiments that was increased in the absence of BBS proteins, we observed BBS8 KD cells experience increased cilia disassembly, these less acetylation at K49, which results in less β-catenin cells may be trying to maintain homeostasis by mediating phosphorylation at T41/S45 and S33/37/T41. Thus, less increased degradation of HEF1, in an effort to maintain cilia β-catenin is targeted for degradation. Moreover, upon loss length and limit the extent of cilia disassembly. This phe- of BBS proteins, β-catenin is actively phosphorylated at nomenon is intriguing, especially considering that we only S552, a modification that increases its stabilization and see this after BBS8 KD and not after BBS6 KD, which war- nuclear localization (our data and previous data [19]). rants more in depth examination in the future. Together, these dysregulated PTMs result in aberrant In an effort to elucidate the underlying mechanisms canonical-Wnt hyperactivation upon loss of BBS protein affecting β-catenin stability upon loss of cilia function, function. Although we and others [52] have observed that we focused our attention on post-translational modifica- HDAC6 and AurA can modify β-catenin levels, very little tions (PTMs) of proteins associated with proteasomal deg- is known about the nature of this regulation which needs radation [41]. HDAC6 physically interacts and acetylates further elucidation. β-catenin [52] resulting in altered Wnt signaling. Several In conclusion, we observed transient expression of the studies have demonstrated the importance of PTMs such primary cilium in the developing mouse RPE. As the RPE 1 3 Bardet–Biedl Syndrome proteins regulate cilia disassembly during tissue maturation 771 matures, primary cilia retract, which are accompanied anti-Aurora A (D3E4Q) (Rb, 1:100; CST, 14475), anti-phos- by altered expression of Hef1, AurorA and Hdac6, key pho-Aurora A (Thr288) (C39D8) (Rb, 1:50; CST, 3079), mediators of ciliary disassembly. In control cells, BBS anti-phospho-β-Catenin (Ser33/37/Thr41) (Rb, 1: 200; CST, proteins protect against ciliary disassembly whereas the 9561), anti-Acetyl-β-Catenin (Lys49) (D7C2) (Rb, 1: 150; loss of BBS proteins results in altered ciliary disassembly CST, 9030), and anti-NPHP2 (Rb, 1:150; Abcam, ab65187). components, including HDAC6, likely via interaction and The primary antibodies were detected using Alexa Fluor trafficking of Inversin. This results in HDAC6-mediated 488, 555 and 568 (1:400; Molecular Probes) and CF™640R downstream cross-talk between ciliary disassembly signal- (1:400; Biotium) conjugated secondary antibodies. ing and canonical-Wnt signaling, leading to PTMs result- For western blot, antibodies used were anti-myc-Tag ing in canonical-Wnt hyperactivation. Taken together, (9B11) (Mm, 1:1000, CST, 2276), anti-GFP (Rb, 1:1000; we furthered our understanding into how ciliary proteins Clontech, 632592), anti-Aurora A (D3E4Q) (Rb, 1:1000; modulate cellular signaling pathways and contribute to CST, 14475), anti-phospho-Aurora A (Thr288) (C39D8) maturation of epithelial tissues. (Rb, 1:1000; CST, 3079), anti-β-Catenin (D10A8) (Rb, 1: 1000; CST, 8480), anti-phospho-β-Catenin (Ser33/37/ Thr41) (Rb, 1: 1000; CST, 9561), anti-phospho-β-Catenin Materials and methods (Thr41/Ser45) (Rb, 1: 1000; CST, 9565), anti-Acetyl-β- Catenin (Lys49) (D7C2) (Rb, 1: 1000; CST, 9030), anti- Animals HEF1/NEDD9 (2G9) (Mm, 1: 1000; CST, 4044), anti- HDAC6 (D2E5) (Rb, 1: 1000; CST 7558). Secondary All mouse experiments had ethical approval from appro- antibodies used were IRDye 800 and IRDye 680 (Rb, Mm priate governing bodies. Experiments were performed in or Gt; 1:10000; Li-cor Bioscience). accordance with guidelines provided by ARVO (Associa- For flow cytometry, a primary antibody against Aurora A tion for Research in Vision and Ophthalmology). Animals (D3E4Q) (Rb, 1:100; CST, 14475) and a secondary Alexa were housed under a 12 h light–dark cycle. The morning Fluor 488-labelled anti-rabbit antibody (1: 250) were used. after mating was considered E0.5 and up to 24 h after birth Propidium iodide (PI, Thermo Fisher, P3566)) at 50 μg/ml was considered P0. C57BL/6 mice were used for control at was used for cell cycle analysis. embryonic (E14.5, E16.5 and E18.5), and post-natal stages siRNA was used in our study to knockdown (KD) BBS6 (P1, P7 and adult). Bbs6 and Bbs8 knockout mice have been and BBS8 in hTERT-RPE1 cells. BBS8 siRNA (HSC.RNAI. previously described [1, 69]. N198309.12; IDT), BBS8 siRNA (L-021417-02-0005; Dharmacon), BBS6 siRNA (L-013300-00-0005), HEF1 siRNA (hs.Ri.NEDD9.13; IDT) and non-targeting siRNA Cell culture (D-001810-10-05) were used. Transfections and treatments: Plasmid transfections were hTERT-RPE1 and HEK293T cells were obtained from performed using GeneTrap transfection reagent (made at ATCC and cultured in Dulbecco’s modified Eagle’s medium NEI, NIH, Bethesda, MD, USA). In brief, 6 μl of GeneTrap (DMEM)-F12 (Thermo Fisher) or DMEM (Thermo Fisher) transfection reagent was diluted in 90 μl of DMEM, incu- supplemented with heat-inactivated 10% fetal bovine serum bated for 5 min followed by addition of 2 μg plasmid and (FBS) (LONZA), and 1% penicillin/streptomycin (P/S) then incubated for 20 min at room temperature (RT). The (Thermo Fisher) (Referred to as complete media). Immor- transfection mix was added dropwise to cells in a 6-well talized kidney medullary (KM) cells were obtained from P. plate containing 2 ml complete media. siRNA transfec- Beales and cultured as previously described [27]. tions were performed in 6-well plates with Lipofectamine RNAiMax transfection reagent (Thermo Fisher; 13778150) using a reverse transfection protocol according to the man- Antibodies and siRNAs ufacturer’s instructions. To induce cilia formation, 24 h post-transfection cells were serum-starved with Opti-MEM For immunofluorescence, antibodies used were anti-Arl13b (Thermo Scientific) for up to 48 h. For proteasome, AurA (Rb, 1:1000; Proteintech, 17711-1-AP), anti-acetylated or HDAC6 inhibition experiments, 48 h post-transfections α-tubulin (Mm, 1:800; Sigma, T6793), anti-GT335 (Mm, cells were serum-starved for 24 h followed by treatment with 1:200; Adipogen, AG-20B-0020), anti-β-catenin (Rb, 1:150; 10 µM MG132 (Calbiochem), 1 µM AurA Inhibitor I (Sell- CST, D10A8), anti- acetylated α-tubulin (Rb, 1:1000; eckchem) and 2 µM tubacin (Sigma), respectively, for the Abcam, ab11317), anti-pericentrin2 (Gt, 1:200; SantaCruz, indicated time (5 h) followed by western blot analysis and SC28145), and anti-ZO-1 (Mm, 1:150; Thermo Fisher, ZO1- immunofluorescence. DMSO was taken as vehicle control 1A12, 339188), anti-GFP (Rb, 1:5000; Clontech, 632592), for treatments. 1 3 7 72 S. R. Patnaik et al. Tissue preparation and Immunohistochemistry Fluorescence‑activated cell sorting (FACS) analyses Mouse eyes were enucleated and immersed in cold phos- For FACS, RPE1 cells were stained with an antibody phate-buffered saline (PBS) and kept on ice for 20 min. directed against intracellular AurA. Recovered cells were Eyes were then placed in 1X PBS and the cornea, lens fixed using 4% PFA for 10 min and washed three times with and retina were removed. The resulting eyecups were then PBS. Cells were permeabilized with 90% ice-cold metha- fixed with 4% paraformaldehyde (PFA) in PBS for 1 h at nol for 30 min and rinsed three times. Cells were blocked RT, then washed three times with 1X PBS and incubated using 0.5% bovine serum albumin (BSA) in PBS and incu- with 50 mM NH4Cl for 10 min, followed by incubation with bated with AurA for 1 h at RT, then washed three times with β-Mercaptoethanol for 10 min. Eyecups were permeabilized 0.5% BSA/PBS. After incubation with a secondary antibody with PBSTX (0.3% Triton-X) and blocked with blocking (Alexa Fluor 488-labelled anti-rabbit) for 45 min at RT, buffer (0.1% Ovalbumin, 0.5% Fish gelatine in PBS) at RT cells were finally washed with 0.5% BSA/PBS. Cells were for 2 h followed by overnight incubation in primary antibody acquired using the Invitrogen Attune NxT Flow Cytometer at 4 °C. Samples were washed three times with 1X PBS fol- (Thermo Fisher Scientific, Inc., USA), and analyzed using lowed by incubation in secondary antibody and DAPI for FlowJo (Treestar, CA, USA). For cell cycle analysis, RPE1 2 h at RT. Finally, samples were washed with PBS for three cells were detached and fixed with 70% ethanol for 30 min, times before mounting on glass slides. Cells close to the followed by incubation with 100 μg/ml RNase A solution optic nerve were considered near the center; cells closer to and 50 μg/ml propidium-iodide solution. Samples were the edge of the eye cup were considered as peripheral. For acquired and analyzed as described above. isolation of pure RPE cells, eyecups were incubated with trypsin at 37 °C for 30–90 min depending on the age of tis- Pulldown and western blotting sue. RPE cells were mechanically removed from underlying choroid and isolated by hand. Choroidal and retinal contami- For pulldown experiments, HEK cells were transiently co- nation was checked via qPCR. Contaminated samples were transfected with Inversin-GFP and pCMV-BBS6/2-myc [27] removed from the analysis. or empty plasmids. 48 h post-transfections cells were lysed hTERT-RPE1 cells were fixed with 4% PFA for 10 min using RIPA buffer supplemented with EDTA-free protease and permeabilized for 15 min with PBSTX. Immunostain- inhibitor cocktail (Halt™ Protease and Phosphatase Inhibitor ing was performed as described above. KM cells were fixed Cocktail (100X), Thermo Fisher). Pulldown was performed with 100% methanol for 10 min on ice. Immunostaining was using agarose beads (GFP-Trap-A, ChromoTek) according performed as described above. to the manufacturer’s instructions followed by western blot. Specimens were imaged on a Leica DM6000B micro- Proteins were harvested in Laemmli sample buffer and sepa- scope (Leica, Bensheim, Germany). Images were deconvo- rated on 8–10% SDS–polyacrylamide gel (PAGE), followed luted and co-localization profiles were generated with Leica by transfer PVDF membrane ( Immobilon®-FL PVDF mem- imaging software (BlindDeblur Algorithm, one iteration brane, Sigma, 05317). The blots were blocked with 5% milk step). Images were processed and cilia length measurements or Applichem blocking buffer (0.2% AppliChem Blocking were performed using Fiji/ImageJ software (NIH, Bethesda, Reagent, 10 mM TrisHCl, 150 mM NaCl, 0.04% NaN3, in USA). ddH2O; pH 7.4) and probed with antibodies as listed above. The blots were scanned for infrared fluorescence at 680 or PLA assay 800 nm using the Odyssey Infrared Imaging System (Licor). Densitometry analysis was performed with Fiji/ImageJ soft- Direct in situ protein–protein interactions were investigated ware (NIH, Bethesda, MD, USA) and the expression levels by means of a proximity ligation assay (PLA) using Duolink were normalized to the input. In Situ FarRed Kit Mouse/Rabbit (Sigma) according to the manufacturer’s instruction. Cells were incubated with anti-myc and anti-Inversin primary antibodies followed by Quantitative real‑time reverse transcriptase anti-rabbit PLUS and anti-mouse MINUS secondary PLA polymerase chain reaction probes. The two complementary oligonucleotides were then hybridized, ligated and rolling circle amplified by the pro- The total RNA was extracted either from hTERT-RPE1 vided polymerase, resulting in fluorescence signals when the cells, retina or RPE tissue using TRIzol reagent (Thermo targeted proteins were closer than 40 nm. TRITC–phalloidin Fisher, 15596026) following manufacturer’s instructions. (Sigma) was used for visualization of cells and DAPI for 1 μg of RNA was reverse transcribed to cDNA using GoS- nuclear staining. cript reverse transcription system (Promega, A5000). cDNA was amplified on a StepOnePlus™ Real-Time PCR System 1 3 Bardet–Biedl Syndrome proteins regulate cilia disassembly during tissue maturation 773 Table 1 Primers Gene Species Forward Reverse BBS6 Human AATG AC ACT GCC TGG GAT G TCG TTG TGA GTC TTG TGT CTG BBS8 Human ATAC TCA TG TGGA AG CCAT CG ATA GAA GCA ACA CAG CCC C HEF1 Human CAT AACC CG CCA GAT GCT AAA CCG GGT GCT GCC TGT ACT AurA Human GAA TGC TGT GTGT CT GTC CG GCCT CT TCT GTA TCC CAA GC HDAC6 Human CAA CTG AGA CCG TGG AGA G CCT GTG CGAG AC TGTA GC NPHP2 Human GCCT TC AAAA TCC AA GCTG TC CTGT TC TGC CTC TTT TCGT TTG GAPDH Human GAG TCA AGG GAT TTGG TC GT TTG ATT TTGG AG GGA TCT CG Hef1 Mouse GTA CCC ATC CAG ATAC CA AAAGG GGA ATG TCA TAT ACCC CTT GAGG AurA Mouse CAC ACG TAC CAG GAG ACTT AC AGA AGT CTT GAAA TG AGG TCC CTG GCT Hdac6 Mouse GGAG AC AAC CCA GTA CATG AA TGA A CGGA GG ACA GAG CCT GTAG Arl13b Mouse AGC GGAT GT GAT TGA GTG TC ACA AGGT TC GAT CTG ACA CAG Ift20 Mouse AAGG AA CCA AAG CATC AA GAA TTA G AG ATG TCA TCAG GC AGC TTG AC Prph2 Mouse TCT CCTC CAA GG AGG TCA AAG GAGT CC GGC AGT GAT GCT CAC Rpe65 Mouse ACT TCCC CT TTC AAT CTCT TCC TTT TAAC TT CTT CCC AATT CT CAC G Cdh5 Mouse ACA CCTT CA CCA TTG AGAC AG CTG CTC AGGT AT TCG TAT CGG Gapdh Mouse CGA CTT CAAC AG CAA CTC CCAC TC TTCC TGG GTG GTC CAGG GT TTC TTAC TC CTT (Applied Biosystems, 4376600) using SYBR Green (Thermo stimulated with Wnt3a conditioned media and luciferase Fisher; Platinum™ SYBR™ Green qPCR SuperMix-UDG, activity was measured after 24 h in a Tecan Infinite M200 11733046) according to the manufacturer’s recommenda- Pro plate reader. Firefly luciferase activity was normalized tion. The following cycling conditions were used: 95 °C for to Renilla luciferase activity in each well. 10 min followed by 40 cycles of 95 for 15 s, 60 for 1 min. Specificity of the amplified product was determined by melt Statistical analysis curve analysis. Relative target gene expression was normal- ized to GAPDH and analyzed by comparative Ct or 2ΔΔCT Statistical analysis was performed using Graphpad Prism method [70, 71]. For a list of primers used, see Table 1. 7.0 software (GraphPad Software Inc., San Diego, CA, USA). For multigroup comparisons, ANOVA followed by Electron microscopy Dunnett’s multiple comparison test, Turkeys multiple com- parison test and Sidak’s multiple comparison test was per- Electron microscopy was performed as previously described formed depending of the data to be compared. Differences [72]. between two groups were compared using a nonparametric Mann–Whitney U test. p value of 0.05 and below was con- Luciferase assay sidered statistically significant. Statistical tests and number of repetitions are described in the legends. Box plots show To monitor the activity of the Wnt/β-catenin signaling median (middle line), edge of boxes is top and bottom quar- pathway characterized by TCF/LEF-dependent target gene tiles (25–75%), and whiskers represent the ranges for the transcription, reporter gene assays were performed with the upper 25% and the bottom 25% of data values. Outliers were Dual-Glo® Luciferase Assay System (Promega) in a 96-well excluded using the ROUT method (GraphPad Prism). Bar plate. BBS6 and BBS8 siRNA-mediated KD in HEK293T plots show mean ± standard deviation (SD). cells were performed using Lipofectamine RNAiMax trans- Acknowledgments This work was supported by the Alexander Von fection reagent (Thermo Fisher) using a reverse transfec- Humboldt Foundation and the Johannes Gutenberg University. The tion protocol according to the manufacturer’s instructions. authors thank  Uwe Wolfrum, Kerstin Nagel-Wolfrum and Anne After 24 h cells were transiently transfected with plasmids Régnier-Vigouroux for abundant discussion and proofreading. We espe- by X-tremeGENE™ 9 DNA Transfection Reagent (Sigma) cially thank Elisabeth Sehn and Gabriele Stern-Schneider for expert technical assistance and Tina Sedmark for providing TEM specimens according to the manufacturer’s protocol. Plasmids used for analysis. were pRL-TK (Renilla luciferase, 1 ng), TopFlash (5 ng) and the total amount of transfected DNA was equalized to 80 ng Author contributions SRP and HLM-S were responsible for concep- by addition of pcDNA3. 24 h post-transfections cells were tion and experimental design. SRP, VK, LB, A-KV, SS, LRO-C and 1 3 774 S. R. Patnaik et al. HLM-S performed experiments. SRP and VK generated figures. SRP maturation is disrupted in ciliopathy patient cells. Cell Rep. and HLM-S co-wrote the manuscript. 22:189–205 20. Plotnikova OV, Pugacheva EN, Golemis EA (2009) Primary cilia Compliance with ethical standards and the cell cycle. Methods Cell Biol 94:137–1602 1. Kukic I, Rivera-Molina F, Toomre D (2016) The IN/OUT assay: a new tool to study ciliogenesis. Cilia 5:23 Conflict of interest The authors declares that they have no conflict of 22. Pugacheva EN, Jablonski SA, Hartman TR, Henske EP, Golemis interest. E (2007) a. HEF1-dependent Aurora A activation induces disas- sembly of the primary cilium. Cell 129:1351–1363 23. Kim S, Lee K, Choi J-H, Ringstad N, Dynlacht BD (2015) Nek2 activation of Kif24 ensures cilium disassembly during the cell cycle. Nat Commun 6:8087 References 2 4. Fisher SK, Steinberg RH (1982) Origin and organization of pig- ment epithelial apical projections to cones in cat retina. J Compd 1. Ross AJ et al (2005) Disruption of Bardet–Biedl syndrome ciliary Neurol 206:131–145 proteins perturbs planar cell polarity in vertebrates. Nat Genet 25. Nishiyama K, Sakaguchi H, Hu JG, Bok D, Hollyfield JG (2002) 37:1135–1140 Claudin localization in cilia of the retinal pigment epithelium. 2. Schneider L et al (2005) PDGFRαα signaling is regulated through Anat Rec 267:196–203 the primary cilium in fibroblasts. Curr Biol 15:1861–1866 26. Williams CL et  al (2011) MKS and NPHP modules cooper- 3. Goetz SC, Anderson KV (2010) The primary cilium: a signalling ate to establish basal body/transition zone membrane associa- centre during vertebrate development. Nat Rev Genet 11:331–344 tions and ciliary gate function during ciliogenesis. J Cell Biol 4. May-Simera HL, Kelley MW (2012) Cilia, Wnt signaling, and the 192:1023–1041 cytoskeleton. Cilia 1:7 27. Hernandez-Hernandez V et al (2013) Bardet-Biedl syndrome 5. Wheatley DN, Wang AM, Strugnell GE (1996) Expression of proteins control cilia length through regulation of actin poly- primary cilia in mammalian cells. Cell Biol Int 20:73–81 merisation. Hum Mol Genet 22:3858–3868 6. Denman-Johnson K, Forge A (1999) Establishment of hair bundle 28. Patzke S et al (2010) CSPP is a ciliary protein interacting with polarity and orientation in the developing vestibular system of the nephrocystin 8 and required for cilia formation. Mol Biol Cell mouse. J Neurocytol 28:821–835 21:2555–2567 7. McDermott KM, Liu BY, Tlsty TD, Pazour GJ (2010) Primary 29. Wei Q et al (2012) The BBSome controls IFT assembly and cilia regulate branching morphogenesis during mammary gland turnaround in cilia. Nat Cell Biol 14:950–957 development. Curr Biol 20:731–737 3 0. Goetz SC, Bangs F, Barrington CL, Katsanis N, Anderson KV 8. Blitzer AL et al (2011) Primary cilia dynamics instruct tissue (2017) The Meckel syndrome- associated protein MKS1 func- patterning and repair of corneal endothelium. Proc Natl Acad Sci tionally interacts with components of the BBSome and IFT 108:2819–2824 complexes to mediate ciliary trafficking and hedgehog signal- 9. Iomini C, Tejada K, Mo W, Vaananen H, Piperno G (2004) Pri- ing. PLoS One 12:e0173399 mary cilia of human endothelial cells disassemble under laminar 31. Nachury MV et al (2007) A core complex of BBS proteins coop- shear stress. J Cell Biol 164:811–817 erates with the GTPase Rab8 to promote ciliary membrane bio- 1 0. Liang Y, Meng D, Zhu B, Pan J (2016) Mechanism of ciliary genesis. Cell 129:1201–1213 disassembly. Cell Mol Life Sci 73:1787–1802 3 2. Jin H, Nachury MV (2007) The BBSome. Curr Biol 19:472–473 11. Keeling J, Tsiokas L, Maskey D (2016) Cellular mechanisms of 3 3. Otto EA et al (2003) Mutations in INVS encoding inversin ciliary length control. Cells 5:6 cause nephronophthisis type 2, linking renal cystic disease to 12. Caspary T, Larkins CE, Anderson KV (2007) The graded the function of primary cilia and left-right axis determination. response to sonic hedgehog depends on cilia architecture. Dev Nat Genet 34:413–420 Cell 12:767–778 3 4. Plotnikova OV, Golemis EA, Pugacheva EN, Ciliogenesis Cell 1 3. Tran PV et al (2008) THM1 negatively modulates mouse sonic Cycle-Dependent (2008) Cell cycle–dependent ciliogenesis and hedgehog signal transduction and affects retrograde intraflagellar cancer. Cancer Res 68:2058–2061 transport in cilia. Nat Genet 40:403–410 35. Mergen M et al (2013) The nephronophthisis gene product 14. Besschetnova TY et al (2010) Identification of signaling pathways NPHP2/Inversin interacts with Aurora A and interferes with regulating primary cilium length and flow-mediated adaptation. HDAC6-mediated cilia disassembly. Nephrol Dial Transpl Curr Biol 20:182–187 28:2744–2753 15. Thompson CL, Chapple JP, Knight MM (2014) Primary cilia 3 6. Simons M et  al (2005) Inversin, the gene product mutated disassembly down-regulates mechanosensitive hedgehog signal- in nephronophthisis type II, functions as a molecular switch ling: a feedback mechanism controlling ADAMTS-5 expression between Wnt signaling pathways. Nat Genet 37:537–543 in chondrocytes. Osteoarthr Cartil 22:490–498 3 7. Loktev AV et al (2008) A BBSome Subunit Links Ciliogenesis, 16. Sánchez I, Dynlacht BD (2016) Cilium assembly and disassembly. Microtubule Stability, and Acetylation. Dev Cell 15:854–865 Nat Cell Biol 18:711–717 38. Gerdes JM et al (2007) Disruption of the basal body compro- 17. May-Simera H, Nagel-Wolfrum K, Wolfrum U (2016) Cilia— mises proteasomal function and perturbs intracellular Wnt the sensory antennae in the eye. Prog Retin. Eye Res. https ://doi. response. Nat Genet 39:1350–1360 org/10.1016/j.pretey eres. 2017.05.001 39. Oh EC, Katsanis N (2013) Context-dependent regulation of 18. Wheway G, Parry DA, Johnson CA (2014) The role of primary Wnt signaling through the primary cilium. J Am Soc Nephrol cilia in the development and disease of the retina. Organogenesis 24:10–18 10:69–85 40. Liu C et al (2002) Control of beta-catenin phosphorylation/deg- 1 9. May-simera HL et al (2018) Primary cilium-mediated retinal radation by a dual-kinase mechanism. Cell 108:837–847 pigment epithelium maturation is disrupted in ciliopathy patient 4 1. Valenta T, Hausmann G, Basler K (2012) The many faces and cells article primary cilium-mediated retinal pigment epithelium functions of β-catenin. EMBO J 31:2714–2736 1 3 Bardet–Biedl Syndrome proteins regulate cilia disassembly during tissue maturation 775 42. Boatright JH et al (2015) Methodologies for analysis of patterning 57. Jin H, Nachury MV (2009) The BBSome. Curr Biol in the mouse RPE sheet. Mol Vis 21:40–60 19:R472–R473 43. Pugacheva EN, Golemis EA (2005) The focal adhesion scaffold- 58. Seo S et al (2010) BBS6, BBS10, and BBS12 form a complex with ing protein HEF1 regulates activation of the Aurora-A and Nek2 CCT/TRiC family chaperonins and mediate BBSome assembly. kinases at the centrosome. Nat Cell Biol 7:937–946 Proc Natl Acad Sci USA 107:1488–1493 4 4. Moore FE et al (2010) The WW-HECT protein Smurf2 interacts 59. Sobkowicz HM, Slapnick SM, August BK (1995) The kinocilium with the Docking Protein NEDD9/HEF1 for Aurora A activation. of auditory hair cells and evidence for its morphogenetic role dur- Cell Div 5:22 ing the regeneration of stereocilia and cuticular plates. J Neurocy- 4 5. Konari K et al (1995) Development of the blood-retinal barrier tol 24:633–653 in vitro “ formation of tight junctions as revealed by occludin and 60. Korobeynikov V, Deneka AY, Golemis EA (2017) Mechanisms ZO-1 Correlates with the barrier function of chick retinal pigment for nonmitotic activation of Aurora-A at cilia. Biochem Soc Trans epithelial. Exp Eye Res 61:99–108 45:37–49 4 6. Burke JM, Cao F, Irving PE, Skumatz CMB (1999) Expression of 61. Jang C, Coppinger JA, Seki A, Yates JR, Fang G (2009) Plk1 E-Cadherin by human retinal pigment epithelium: delayed expres- and Aurora A regulate the depolymerase activity and the cellular sion in vitro. Invest Ophthalmol Vis Sci 40:2963–2970 localization of Kif2a. J Cell Sci 122:1334–1341 47. Gibbs D et al (2004) Role of myosin VIIa and Rab27a in the 6 2. Otto EA et al (2005) Nephrocystin-5, a ciliary IQ domain protein, motility and localization of RPE melanosomes. J Cell Sci is mutated in Senior-Loken syndrome and interacts with RPGR 26:6473–6483 and calmodulin. Nat Genet 37:282–288 4 8. Hubbert C et al (2002) HDAC6 is a microtubule-associated dea- 6 3. Kinzel D et al (2010) Pitchfork regulates primary cilia disassem- cetylase. Nature 417:455–458 bly and left-right asymmetry. Dev Cell 19:66–77 4 9. Hideshima T et al (2005) Small-molecule inhibition of proteasome 64. Gabriel E et al (2016) CPAP promotes timely cilium disassembly and aggresome function induces synergistic antitumor activity in to maintain neural progenitor pool. EMBO J 35:699–791 multiple myeloma. Proc Natl Acad Sci USA 102:8567–8572 6 5. Liu YP et al (2014) Ciliopathy proteins regulate paracrine signal- 5 0. Yuan H et al (2012) Overcoming CML acquired resistance by ing by modulating proteasomal degradation of mediators. J Clin specific inhibition of Aurora A kinase in the KCL-22 cell model. Invest 124:2059–2070 Carcinogenesis 33:285–293 6 6. Mahuzier A et al (2012) Dishevelled stabilization by the ciliopathy 51. Corbit KC et al (2008) Kif3a constrains beta-catenin-dependent protein Rpgrip1 l is essential for planar cell polarity. J Cell Biol Wnt signalling through dual ciliary and non-ciliary mechanisms. 198:927–940 Nat Cell Biol 10:70–76 67. Long H, Wang Q, Huang K (2015) Ciliary/flagellar protein ubiq- 5 2. Li Y, Zhang X, Polakiewicz RD, Yao TP, Comb MJ (2008) uitination. Cells 4:474–482 HDAC6 is required for epidermal growth factor-induced β-catenin 6 8. Cao M, Li G, Pan J (2009) Regulation of cilia assembly, disas- nuclear localization. J Biol Chem 283:12686–12690 sembly, and length by protein phosphorylation. Methods Cell Biol 5 3. Gerhardt C, Leu T, Lier JM, Rüther U (2016) The cilia-regulated 94:333–346 proteasome and its role in the development of ciliopathies and 6 9. Tadenev ALD et al (2011) Loss of Bardet-Biedl syndrome pro- cancer. Cilia 5:14 tein-8 (BBS8) perturbs olfactory function, protein localization, 54. Verheyen EM, Gottardi CJ (2010) Regulation of Wnt/β-catenin and axon targeting. Proc Natl Acad Sci USA 108:10320–10325 signaling by protein kinases. Dev Dyn 239:34–44 7 0. Livak KJ, Schmittgen TD (2001) Analysis of relative gene 5 5. Forcioli-Conti N, Lacas-Gervais S, Dani C, Peraldi P (2015) The expression data using real-time quantitative PCR and. Methods primary cilium undergoes dynamic size modifications during 25:402–408 adipocyte differentiation of human adipose stem cells. Biochem 71. Pfaffl MW (2001) A new mathematical model for relative quanti- Biophys Res Commun 458:117–122 fication in real-time RT-PCR. Nucleic Acids Res 29:45e–45 5 6. Nachury MV et al (2007) A core complex of BBS proteins cooper- 7 2. Sedmak T, Wolfrum U (2010) Intraflagellar transport molecules in ates with the GTPase Rab8 to promote ciliary membrane biogen- ciliary and nonciliary cells of the retina. J Cell Biol 189:171–186 esis. Cell 129:1201–1213 1 3 Publications & Manuscripts Manuscript I 22 Publications & Manuscripts The actin-bundling protein Fascin-1 modulates ciliary signalling. Lena Brücker1, Stefanie Kornelia Becker1, Gregory Harms2, Maddy Parsons3, Helen Louise May-Simera1 1Cilia Cell Biology, Institute of Molecular Physiology, Johannes-Gutenberg University, Mainz, Germany 2Imaging Core Facility, Cell Biology Unit, University Medical Centre, Johannes Gutenberg University, Mainz, Germany 3Randall Centre for Cell and Molecular Biophysics, Kings College London, London, UK Corresponding author: Helen L. May-Simera (may-simera@uni-mainz.de) Keywords: Cilia, Actin, Wnt, Signalling, Ciliopathy, Bardet-Biedl Syndrome, Filopodia Abstract Primary cilia are microtubule-based cell organelles important for cellular communication. Since they are involved in the regulation of numerous signalling pathways, defects in cilia development or function are associated with genetic disorders, collectively called ciliopathies. Besides their ciliary functions, recent research has shown that several ciliary proteins are involved in the coordination of the actin cytoskeleton. However, the interconnection of ciliary and actin phenotypes is not fully understood. Here we show that the protein BBS6/MKKS, associated with the ciliopathy Bardet-Biedl syndrome, cooperates with the actin-bundling protein Fascin-1 in regulating filopodia and ciliary signalling. We found that loss of Bbs6 affects filopodia length potentially via interaction with Fascin-1. Conversely, loss of Fascin-1 leads to a ciliary phenotype, subsequently affecting ciliary Wnt signalling, possibly in collaboration with Bbs6. Our data shed light on how ciliary proteins are involved in actin regulations and provide new insight into the involvement of the actin regulator Fascin- 1 in ciliogenesis and cilia-associated signalling. Expanding our knowledge of the complex regulations between primary cilia and actin dynamics is important to understand the pathogenic consequences of ciliopathies. With Fascin-1, we have further expanded the repertoire of potential ciliopathy genes that should be screened for in undiagnosed ciliopathy patients. M-I 1 Publications & Manuscripts Introduction Primary cilia are microtubule-based sensory cell protrusions vital for cell homeostasis and tissue development. They act as sensory antennae, receiving and transducing cues related to cellular signalling pathways such as sonic hedgehog (Shh), platelet- derived growth factor (PDGF) or Wnt (Goetz and Anderson, 2010; Wallingford and Mitchell, 2011; May-Simera and Kelley, 2012; Lee, 2020). Thus, defects in primary cilia or ciliary proteins are known to be associated with a group of genetic disorders, so- called ciliopathies (Reiter and Leroux, 2017; Chen et al., 2021). Although primary cilia are predominantly microtubule-based organelles which coordinate the cellular microtubule network, ciliary defects also disrupt regulation of the actin cytoskeleton (Brücker et al., 2020; Smith et al., 2020). Conversely, actin polymerisation is a negative regulator of ciliogenesis (Bershteyn et al., 2010; Kim et al., 2010, 2015; Liang et al., 2016). The interconnected phenotype between primary cilia and actin dynamics is complex and not fully understood, which is why any new insights into these processes would have wide reaching consequences. Numerous ciliary proteins have already been shown to coordinate the actin cytoskeleton, emphasising the interplay between cilia and actin (Yin et al., 2009; Kim et al., 2010; May-Simera et al., 2016). An important subset of cilia proteins involved in actin dynamics are the BBS proteins, defects in which are associated with the archetypical ciliopathy Bardet-Biedl syndrome (BBS). Besides their classically defined function in cilia development, maintenance and trafficking (Wei et al., 2012; Nozaki et al., 2019; Patnaik et al., 2019), BBS proteins have been shown to be associated with downstream actin perturbations (Novas et al., 2015). Loss of BBS4, 6, 8 or 15, which exert different ciliary functions, result in defective actin-based cell migration and a disorganisation of the actin cytoskeleton (Cui et al., 2013; Hernandez-Hernandez et al., 2013). This is associated with upregulation of downstream RhoA signalling resulting in increased numbers of focal adhesions. In zebrafish, bbs8 was further found to be required for neural crest cell migration and migration of fibroblasts, and its loss was accompanied by a lack of polymerisation of the actin cytoskeleton and disorganised microfilaments (Tobin et al., 2008). However, the direct link between ciliary BBS proteins and the actin cytoskeleton is still unclear. Many actin phenotypes caused by ciliary defects thus far could be ascribed to aberrant non-canonical Wnt signalling (planar cell polarity, PCP), a pathway known to affect downstream actin networks (Gerdes et al., 2007; Corbit et al., 2008; May-Simera et al., 2010, 2015; Cui et al., 2013; McMurray et al., 2013; Balmer et al., 2015; Wang et al., 2017). Upon activation of this pathway by Wnt ligands binding to the Frizzled receptor, the ciliary PCP protein Inversin recruits Dishevelled to the plasma membrane (Simons et al., 2005). Dishevelled in turn binds to formins and small GTPases, subsequently activating downstream actin regulators such as RhoA, Rock and Jnk (Habas et al., 2001; Liu et al., 2008). Thus, Inversin acts as a key player in the switch from canonical to non-canonical Wnt signalling, inhibiting canonical Wnt and promoting directional cell migration via regulation of Rho GTPases and the downstream actin network (Simons M-I 2 Publications & Manuscripts et al., 2005; Lienkamp et al., 2012; Veland et al., 2013; Werner et al., 2013). PCP signalling also results in the development of actin-based signalling filopodia which further distribute the Wnt signal to recipient cells (Stanganello et al., 2015; Mattes et al., 2018; Rosenbauer et al., 2020). Recent data indicate that BBS2, BBS6 and BBS8 interact with Inversin, facilitating its transport to the base of the cilium and enabling its function in non-canonical Wnt signalling (May-Simera et al., 2018; Patnaik et al., 2019). Consistently, knockout of bbs6 and bbs8 in zebrafish lead to enhanced canonical Wnt signalling and a PCP phenotype, supporting the cooperation between Inversin and BBS proteins (Ross et al., 2005; Gerdes et al., 2007; May-Simera et al., 2010, 2015). Besides the reciprocity between ciliary proteins and Wnt signalling in regulating actin dynamics, it is plausible that there is a more direct connection between cilia and the actin cytoskeleton. Numerous proteins have been associated in directly regulating the actin cytoskeleton, enabling cell migration, trafficking and morphology. Since primary cilia are microtubule-based organelles, actin-binding proteins that also affect the microtubule network are of particular interest. Prominent examples for this include MACF1, the microtubule-actin crosslinking factor, the inverted formin 1 (FHDC1), and Fascin-1, an actin-bundling protein important for filopodia formation (Wu et al., 2008; Young et al., 2008; Thurston et al., 2012; Antonellis et al., 2014; Villari et al., 2015). For MACF1 and FHDC1, a role in ciliogenesis has already been described (May- Simera et al., 2016; Copeland et al., 2018); however, a functional link between Fascin- 1 and ciliary proteins has not been investigated. In the current work, we shed light on the functional regulation between ciliary proteins and actin. We show that Bbs6 deficient cells exhibit a filopodia phenotype, correlating with BBS6 building a complex with the filopodia regulator Fascin-1. Interestingly, knockdown of Fascin-1 affected cilia number, suggesting a role of Fascin-1 in initiating ciliogenesis. Furthermore, we found Fascin-1 that cooperates with Bbs6 in regulating ciliary PCP/Wnt signalling via downstream Wnt targets such as Cyclin D1. Taken together, our results demonstrate a role for Fascin-1 in bridging the regulation of primary cilia and actin networks, connecting phenotypes in both ciliogenesis and actin via coordination of signalling pathways such as Wnt. Results Bbs6 regulates filopodia stability via interaction with Fascin-1. Loss of ciliary proteins Bbs6 or Bbs8 was previously shown to be associated with defects in cell migration and disrupted actin networks (Tobin et al., 2008; Hernandez- Hernandez et al., 2013). To further elucidate this association, we analysed filopodia in mouse embryonic fibroblasts (MEFs). Filopodia are actin-based cell protrusions that sense the environment and are thus important for efficient cell migration (Amarachintha et al., 2015). Cells co-expressing mRFP-tagged Lifeact as a marker for the actin cytoskeleton and the EGFP-tagged filopodia regulator Fascin-1 were used to perform live cell imaging to visualise filopodia (Supp. Movies). Analysis of the resulting movies M-I 3 Publications & Manuscripts revealed that Bbs6-/- MEFs assembled shorter filopodia compared to wildtype cells (Fig. 1 A, B; Supp. Movie 1, 2), although localisation of Fascin-1 to filopodia appeared to be similar in fixed cells (Fig. 1 A, C), potentially due to loss of filopodia stability during fixation. This filopodia phenotype is supported by previous studies where a disruption of filopodia was assumed to be the cause of migration defects observed in Bbs6 knockout kidney medullary cells (Hernandez-Hernandez et al., 2013). Despite previous findings that loss of Bbs8 hinders cell migration (Tobin et al., 2008; Hernandez- Hernandez et al., 2013), Bbs8-/- MEFs did not display a phenotype in filopodia length (Supp. Fig. 1 A, B; Supp. Video 3, 4), suggesting Bbs8 is not involved in this aspect of cell environmental sensing. Fig. 1: Loss of the ciliary protein Bbs6 disrupts filopodia dynamics via interaction with Fascin-1. A Live cell imaging of Lifeact (actin cytoskeleton) and EGFP-FSCN1 (filopodia) in Bbs6 wildtype (Bbs6+/+) and knockout (Bbs6-/-) mouse embryonic fibroblasts (MEFs), 48 h after transfection. Images represent one timepoint out of 30, videos are shown in supplementary data. B Average filopodia length via FiloQuant analysis shows significantly shorter filopodia upon Bbs6 knockout (Mann-Whitney-U test, p=0.000001). N(Bbs6+/+)=93, N(Bbs6-/-)=70. C Bbs6 MEFs fixed with methanol and stained with Fascin1 (red) for filopodia visualisation. Fascin-1 localises to filopodia in Bbs6 wildtype and knockout MEFs, showing no defect in localisation. D Interaction study between Fascin-1 and Bbs6. GFP pulldowns were performed 48 h after overexpression of EGFP-FSCN1 and MYC-BBS6 in HEK293T cells. The interaction between EGFP-INVS (Inversin) and MYC-BBS6 was used as positive control, EGFP-empty served as negative control. Red box shows formation of a complex between EGFP-FSCN1 and MYC- BBS6. Blots represent a cropped version of Supp. Fig. 2C. Scale bars: 10µm. *p<0.05, **p<0.01, ***p<0.001. Experiments were repeated at least 3 times. M-I 4 Publications & Manuscripts Since Fascin-1 is the key actin-bundling protein organising F-actin structures in filopodia (Kureishy et al., 2002; Vignjevic et al., 2006; Pfisterer et al., 2020), we adopted a candidate approach to determine whether the ciliary proteins Bbs6 and Bbs8 form a complex with Fascin-1. EGFP-FSCN1, MYC-BBS6, MYC-BBS8 or empty vector controls were expressed in HEK293T cells and GFP pulldown experiments performed to assess complex formation. The previously described interaction between BBS6 and Inversin/INVS was used as a positive control (Patnaik et al., 2019). EGFP-FSCN1 pulled down MYC-BBS6, but not MYC-BBS8 (Fig. 1 D; Supp. Fig. 1 C). Taken together, these data indicate a regulation of filopodia via Bbs6, but not Bbs8, possibly via association with Fascin-1. Functional interaction between Bbs6 and Fascin-1 in cell migration is independent of transcriptional regulation. To understand whether Bbs6 and Fascin-1 may cooperate by influencing stability of expression of key regulatory proteins, we sought to investigate how these proteins influence one another. For this, we analysed the expression levels of actin and ciliary components (Arl13b and poly-glutamylated tubulin) upon loss or knockdown of Bbs6 and Fascin-1. Analysis of Bbs6 knockout cells showed no change in levels of Fascin-1, actin and Arl13b proteins, but a significant reduction in poly-glutamylated tubulin indicating a regulation of Bbs6 in the posttranslational modification of tubulin (Fig. 2 A, B). Knockdown of Fascin-1 in MEFs was performed using siRNA and validated via RT- qPCR, western blots and immunofluorescence (Supp. Fig. 2). No changes in expression levels of any of the target proteins were detected upon knockdown of Fascin-1, noting the lack of a reliable antibody for Bbs6 precluded us from analysing levels of this protein. Loss of Bbs6 or Fascin-1 did not affect mRNA levels of beta-actin, Arl13b or Bbs6 (Fig. 2 C). Taken together, these results show that, with the exception of poly-glutamylated tubulin, the transcription and translation of these targets are not dependent on Bbs6 or Fascin-1. It was previously reported that BBS proteins play a role in the ubiquitination of signalling receptors and their retention inside the primary cilium (Xu et al., 2015; Shinde et al., 2020). Fascin-1 is monoubiquitinated at Lys247 and Lys250 within the second actin-binding site (Lin et al., 2016). Although we did not see a change in total protein level of Fascin-1 upon knockout of Bbs6 (Fig. 2 A, B), we sought to determine whether Bbs6 is involved in the ubiquitin-dependent degradation of Fascin-1. We immunoprecipitated endogenous Fascin-1 from Bbs6 wildtype and knockout cells treated with and without the proteasome inhibitor MG132 to prevent degradation of ubiquitinated Fascin-1 protein. After probing the western blots with an antibody against Ubiquitin, we did not see any increase or change in the amount of ubiquitinated Fascin- 1 between wildtype and knockout samples (Supp. Fig. 3), indicating that Bbs6 has no effect on ubiquitin-dependent proteasomal degradation of Fascin-1. These findings M-I 5 Publications & Manuscripts indicate that functional crosstalk between Bbs6 and Fascin-1 does not occur through control of protein stability or expression of each protein. Fig. 2: Transcriptional regulation of Bbs6 and Fascin-1. A Protein levels of Fascin-1, Actin, poly-glutamylated tubulin (detected via Gt335) and Arl13b in MEFs shown by western blots. B Analysis of the protein expression levels in western blots (AUC) in Bbs6-/- knockout and Fascin knockdown MEFs, normalised to Gapdh and in comparison to the WT/non- targeting control (siNTC) sample (red line). No significant differences in the expression of all proteins could be detected, except for poly-glutamylated tubulin, which was significantly downregulated in Bbs6- /- MEFs (p=0.02) and Fascin-1, whose expression is downregulated upon its knockdown. C mRNA levels of Fascin-1, beta-actin, Arl13b and Bbs6 in MEFs measured via RT-qPCR. No significant differences in the mRNA levels of all genes, except for Fascin-1, whose expression is downregulated upon its knockdown. Normalisation to the wildtype/siNTC samples (red line). Student’s t-test: n.s. p>0.05, *p<0.05, **p<0.01, ***p<0.001. Experimental procedures were repeated at least 3 times. Loss of Fascin-1 is associated with a ciliary phenotype in mouse embryonic fibroblasts. The observed complex between Fascin-1 and Bbs6 and the filopodia phenotype in Bbs6 depleted cells suggests that these proteins cooperate in cellular processes. Although the primary cilium is predominantly a microtubule-based structure, actin related proteins also play an important role in ciliogenesis (Bershteyn et al., 2010; Kim et al., 2010, 2015; Pitaval et al., 2010; Liang et al., 2016). To investigate whether this might be also true for Fascin-1, we quantified number and length of primary cilia after Fascin-1 knockdown. M-I 6 Publications & Manuscripts Fig. 3: Loss of Fascin-1 causes a ciliary phenotype. A Loss of Fascin-1 via siRNA mediated knockdown in MEFs (siFscn1) led to significantly reduced numbers of ciliated cells compared to transfection with non-targeting control siRNAs (siNTC). Transfected MEFs were cultured in serum-depleted medium for 24 h to induce ciliation before fixation with 4% PFA. Visualisation of primary cilia (arrow heads) with the ciliary membrane marker Arl13b (green) and the basal body protein PCNT (red). Scale bar: 10µm. B Quantification of ciliated cells upon knockdown of Fascin-1. Knockdown of Fascin-1 results in significantly reduced cilia numbers (Mann- Whitney-U test, p=0.000037), N(siNTC)=438, N(siFscn1)=395. C Analysis of ciliary length of siNTC and siFscn1 did not reveal significant differences (Mann-Whitney-U test, p=0.10461), N(siNTC)=315, N(siFscn1)=212. D Numbers of cilia according to their subclass of length show no significant differences between siNTC and siFscn1. Subclasses were divided between 0-1µm, 1-2µm, 2-3µm, 3-4µm and above 4µm and numbers of each cilia class are given in percentage. E Bbs6 MEFs transfected with siNTC and siFscn1 were cultured in serum-depleted medium before fixation with 4% PFA. Visualisation of primary cilia (arrow heads) with the ciliary membrane marker Arl13b (green) and the basal body M-I 7 Publications & Manuscripts protein PCNT (red). Scale bars: 10µm. F Quantification of ciliated cells upon knockdown of Fascin-1 (siFscn1) in Bbs6 wildtype and knockout cells reveals a significant upregulation in cilia numbers upon loss of Bbs6 and downregulation upon loss of Fascin-1. Double loss of Bbs6 and Fascin-1 rescues cilia numbers again, showing no significant difference in comparison to Bbs6+/+ siNTC. N(Bbs6+/+,siNTC)=462, N(Bbs6+/+,siFscn1)=458, N(Bbs6-/-,siNTC)=393, N(Bbs6-/-,siFscn1)=363. G Analysis of ciliary length between siNTC and siFscn1 in both Bbs6 wildtype and knockout MEFs showing no significant differences between all samples. N(Bbs6+/+,siNTC)=123, N(Bbs6+/+,siFscn1)=42, N(Bbs6-/-,siNTC)=156, N(Bbs6-/-,siFscn1)=51. H Numbers of cilia according to their subclass of length reveals no significant differences in length subclasses upon loss of Bbs6 and/or Fascin-1. Subclasses were divided between 0-1µm, 1-2µm, 2-3µm, 3-4µm and above 4µm and numbers of each class are given in percentage. I Visualisation of overexpressed EGFP-FSCN1 in serum-depleted MEFs. Costaining of Arl13b and PCNT as cilia proteins revealed localisation of EGFP-FSCN1 to cilia. Scale bar: 8µm. Mann-Whitney-U test: n.s. p>0.05, *p<0.05, **p<0.01, ***p<0.001. Data represent at least three independent experiments. Loss of Fascin-1 in MEFs led to significantly reduced numbers of ciliated cells (~50%) compared to transfection with non-targeting control siRNAs (~80%) (Fig. 3 A, B). We also quantified primary cilia length to analyse whether these ciliation defects are due to a deficiency in the process of cilia initiation, assembly, or disassembly. Despite fewer cilia, no changes in cilia length were seen following Fascin-1 depletion (Fig. 3 C, D), suggesting the ciliation defect is most likely a consequence of failed initiation. Loss of Bbs6 has been shown to increase ciliation in kidney medullary cells (Volz et al., 2021). To further analyse the interplay between Bbs6 and Fascin-1 in ciliogenesis, we analysed whether knockdown of Fascin-1 in Bbs6 depleted cells could rescue their ciliary phenotype. As expected, knockout of Bbs6 lead to a significant increase in cilia number (Fig. 3 E, F), although length was not affected (Fig. 3 G-H). Fascin-1 depletion in Bbs6 knockout cells resulted in a reduction in the enhanced cilia numbers, showing a rescue in the ciliation phenotype (Fig. 3 F). These results show that Fascin-1 is required for ciliogenesis in MEFs and potentially acts antagonistically to Bbs6. Fascin-1 has been shown to localise to primary cilia of murine fibroblasts, where it was suggested to assist actin based ciliary decapitation (Phua et al., 2017). To verify this Fascin-1 localisation, we overexpressed EGFP-tagged Fascin-1 in MEFs and performed fluorescence microscopy. A distinct localisation of EGFP-FSCN1 at both the basal body and along the ciliary axoneme was observed in a small proportion of cells (Fig. 3 I), suggesting this recruitment is either transient or linked to a specific state of ciliogenesis. The actin and microtubule binding properties of Fascin-1 can be influenced via the manipulation of S39 and S274 phosphorylation sites within the two actin-binding domains (Villari et al., 2015). We therefore tested whether overexpression of the phospho-mimetic construct with decreased actin-binding capacity (S274D) showed stronger localisation to primary cilia as it binds to microtubules more efficiently. Expression of this mutant did not increase ciliary localisation of Fascin-1, and nor did the overexpression of other mutant forms of Fascin-1 (S39A, S39D, S274A) that are known to influence cytoskeletal binding (Supp. Fig. 4). Taken together, we identified M-I 8 Publications & Manuscripts Fascin-1 as a positive regulator of ciliogenesis that can transiently be recruited to the cilium. Fascin-1 is involved in the regulation of ciliary Wnt signalling. Since loss of Fascin-1 results in a reduction in ciliated cells, we sought to determine further downstream effects. Primary cilia regulate several signalling pathways, including Wnt signalling which can modulate actin network assembly (Fig. 4 A) (Gerdes et al., 2007; Corbit et al., 2008; May-Simera et al., 2010, 2015; Cui et al., 2013; McMurray et al., 2013; Balmer et al., 2015; Wang et al., 2017). BBS6 and Inversin interact and regulate the switch from canonical to non-canonical Wnt signalling (Simons et al., 2005; Gerdes et al., 2007; Patnaik et al., 2019). Since we identified Fascin-1 in a complex with BBS6, we hypothesised that it might also interact with Inversin. We overexpressed mRFP-tagged FSCN1 and EGFP-INVS or empty vector controls and performed GFP pulldown experiments to assess complex formation. The interaction between MYC-BBS6 and EGFP-INVS was used as a positive control (Patnaik et al., 2019). EGFP-INVS pulled down mRFP-FSCN1, indicating an interaction between both proteins (Fig. 4 B). These data suggest a function for Fascin-1 in cilia-related Wnt signalling. For this, we examined mRNA levels of key Wnt signalling proteins after knockdown of Fascin-1 in comparison to Bbs6 knockout. Knockdown of Fascin-1 in MEFs led to a significant increase in mRNA expression of Cyclin D1, a downstream target of canonical Wnt, although other Wnt effectors were not affected (Fig. 4 C). This effect was mirrored by loss of Bbs6, also significantly enhancing Cyclin D1 mRNA expression levels in addition to other Wnt pathway components Lrp5/6, Dvl2, Inversin and Axin2 (Fig. 4 B). Since loss of Bbs6 in known to activate canonical Wnt signalling (Gerdes et al., 2007; Patnaik et al., 2019; Volz et al., 2021), it is plausible that this is facilitated via a transcriptional upregulation of Cyclin D1 and Lrp6 and downregulation of Axin2. Dvl2 is known to interact with Inversin in mediating non-canonical Wnt. Thus, the transcriptional upregulation of these genes might be a mechanism to compensate the hyperactivation of canonical Wnt due to loss of Bbs6. Upregulation of Cyclin D1 upon loss of Fascin-1 was confirmed via immunocytochemistry. The intensity of Cyclin D1 inside the nucleus was significantly enhanced upon knockdown of Fascin-1 (Fig. 4 D, E), suggesting an activation of canonical Wnt signalling (Shtutman et al., 1999; Tetsu and McCormick, 1999). Since primary cilia were shown to modulate Wnt signalling (Gerdes et al., 2007; Corbit et al., 2008), these data indicate the upregulation of canonical Wnt signalling being a consequence of the ciliary phenotype. M-I 9 Publications & Manuscripts Fig. 4: Fascin-1 regulates ciliary Wnt signalling. A Graphical representation of canonical and non-canonical (PCP) Wnt signalling. Upon activation of canonical Wnt via binding of the Wnt ligand to a coreceptor complex consisting of LRP5/6 and Frizzled (FZD), Dishevelled (DVL) inactivates the beta-catenin degradation complex (Axin, GSK3, APC, CK1). Beta-catenin (β-cat) accumulates and enters the nucleus where it acts as coactivator of transcription factor TCF/LEF that activate the transcription of Wnt target genes such as Cyclin D1 and Myc. During non-canonical Wnt, Dishevelled is translocated via Inversin, so that beta-catenin gets degraded. Dishevelled activates downstream signalling cascades activating actin networks via regulation of Rac, Daam and Rho GTPases. B Interaction study between Fascin-1 and Inversin/INVS. GFP pulldowns were performed 48 h after overexpression of mRFP-FSCN1 and EGFP-INVS in HEK293T cells. The interaction between EGFP-INVS and MYC-BBS6 was used as positive control, EGFP-empty served as negative control. Red box shows formation of a complex between mRFP-FSCN1 and EGFP-INVS. C mRNA levels of Wnt signalling genes upon knockdown of Fascin-1 or knockout of Bbs6 in MEFs measured via RT-qPCR. Data shown as fold changes in comparison to the WT/siNTC control (red line). M-I 10 Publications & Manuscripts Differential expression of Lrp5/6, Dvl2, Inversin, Axin2 and Cyclin D1 in Bbs6-/- MEFs, whereas only Cyclin D1 was significantly upregulated upon loss of Fascin-1 (red box). Student’s t-test. D Visualisation of Cyclin D1 (green) inside the nucleus of MEFs transfected with siNTC and siFscn1 48 h prior fixation with 4% PFA shows a higher signal of Cyclin D1 upon loss of Fascin-1. Scale bar: 10µm. E Quantification of the fluorescence intensity of Cyclin D1 inside the nucleus of MEFs measured with Fiji in relation to the nucleus area. Nuclear Cyclin D1 is significantly enhanced upon knockdown of Fascin-1 in MEFs (p=8.98*10-26). N(siNTC)=297, N(siFscn1)=282. Mann-Whitney-U test. n.s. p>0.05, *p<0.05, **p<0.01, ***p<0.001. Data represent at least three independent experiments. Fascin-1 cooperates with cilia proteins in modulating Wnt signalling. Given that loss of both Bbs6 and Fascin-1 led to increased Cyclin D1 levels, we next tested whether Bbs6 and Fascin acted synergistically in this pathway. We quantified Cyclin D1 within the nucleus of Bbs6-/- MEFs after knockdown of Fascin-1 (Fig. 5 A-C). In Bbs6 wildtype cells, knockdown of Fascin-1 led to an increase of nuclear Cyclin D1 levels, a similar phenotype to that seen in Bbs6-/- cells (Fig. 5 A, B) (Volz et al., 2021). Since the intensity of Cyclin D1 in Bbs6-/- cells was so high, microscope illumination settings had to be reduced to avoid saturation and enable subsequent analysis (Fig. 5 A, lower panel, and C). Interestingly, this revealed a significant decrease of nuclear Cyclin D1 in Bbs6-/- cells upon Fascin-1 knockdown. Besides being regulated via Wnt signalling, the nuclear localisation of Cyclin D1 is also controlled via the cell cycle. Although it was previously shown that loss of Bbs6 is not associated with major changes in G1-S phase transition, which regulates Cyclin D1 translocation (Kim et al., 2005; Patnaik et al., 2019), we examined a second Wnt signalling target to determine whether this correlated with Cyclin D1 changes. One of the canonical Wnt effectors, beta-catenin, is acetylated at Lys49 via CREB-binding protein (CBP), regulating its transcriptional activity in a promoter specific fashion (Wolf et al., 2002). In wildtype MEFs, localisation of acetylated beta-catenin was restricted to the nucleus (Fig. 5 D), making it a suitable marker for Wnt activity. Significantly enhanced nuclear levels of acetylated beta-catenin were seen in both Fascin-1 knockdown and Bbs6 knockout cells (Fig. 5 D, E). However, additional knockdown of Fascin-1 did not reverse this phenotype as seen before for Cyclin D1. This suggests that Bbs6 and Fascin-1 do not completely overlap in terms of their functional Wnt effect. M-I 11 Publications & Manuscripts Fig. 5: Fascin-1 regulates ciliary Wnt signalling in cooperation with Bbs6. A-C Quantification of nuclear Cyclin D1 after loss of Bbs6 and Fascin-1. A Visualisation of Cyclin D1 inside the nucleus of Bbs6 MEFs transfected with siNTC and siFscn1 48 h prior fixation with 4% PFA. For Cyclin D1 in Bbs6-/- MEFs (lower panel), microscope illumination settings were reduced to avoid saturation and enable subsequent analysis. Scale bars: 10µm. B Quantification of the fluorescence intensity of Cyclin D1 inside the nucleus of Bbs6 MEFs transfected with siNTC or siFscn1 measured with Fiji in relation to the nucleus area shows more nuclear Cyclin D1 upon loss of Fascin-1 or Bbs6. Mann-Whitney-U test. N(Bbs6+/+ siNTC)=157, N(Bbs6+/+ siFscn1)=132, N(Bbs6-/- siNTC)=157, N(Bbs6- /- siFscn1)=157. C Quantification of the fluorescence intensity of Cyclin D1 inside the nucleus of Bbs6-/- MEFs transfected with siNTC or siFscn1 under lower microscopy illumination settings for Cyclin D1 M-I 12 Publications & Manuscripts shows that nuclear Cyclin D1 is significantly reduced after combined loss of Fascin-1 and Bbs6 in comparison to Bbs6-/- (Mann-Whitney-U test: p=0.002). N(Bbs6-/- siNTC)= 157, N(Bbs6-/- siFscn1)= 128. D+E Quantification of nuclear acetylated beta-catenin after loss of Bbs6 and Fasicn-1. D Visualisation of acetylated beta-catenin inside the nucleus of Bbs6 MEFs transfected with siNTC and siFscn1 48 h prior to fixation. Scale bars: 10µm. E Quantification of the fluorescence intensity of acetylated beta- catenin inside the nucleus of Bbs6 MEFs transfected with siNTC or siFscn1 measured with Fiji in relation to the nucleus area. Acetylated beta-catenin is significantly upregulated upon loss of either Bbs6, Fascin-1 or both proteins combined. Mann-Whitney-U test. N(Bbs6+/+ siNTC)=282, N(Bbs6+/+ siFscn1)=211, N(Bbs6-/- siNTC)=309, N(Bbs6-/- siFscn1)=327. n.s. p>0.05, *p<0.05, **p<0.01, ***p<0.001. Data represent at least three independent experiments. Discussion In the current work, we uncover a new role for the actin-bundling protein Fascin-1 in modulating ciliary signalling. We identified that Fascin-1 forms a complex with the ciliary protein Bbs6 which might underlie the filopodia phenotype in ciliary mutants. Conversely, knockdown of Fascin-1 led to a ciliary phenotype correlating with downstream ciliary Wnt signalling. Previous studies have shown that several ciliary proteins are not only associated with ciliary function, but also with actin regulation and subsequent cell migration (Yin et al., 2009; Kim et al., 2010; May-Simera et al., 2016). In particular loss of Bbs6 enhances actin stress fibres and focal adhesions in kidney medullary cells, both key elements of the actin network (Hernandez-Hernandez et al., 2013). Filopodia represent another key element of the actin cytoskeleton as they extend beyond the leading edge of lamellipodia to sense the environment and are thus important to induce cell migration. Live cell imaging of MEFs revealed that filopodia in Bbs6 knockout MEFs were significantly shorter in comparison to wildtype cells, suggesting a defect in environmental sensing. Previously, the actin phenotype upon loss of Bbs6 or Bbs8 was attributed to the regulation of Rho GTPases, affecting downstream actin (Hernandez- Hernandez et al., 2013). Additionally, we identified BBS6 in a complex with the actin regulator Fascin-1. As a functional downstream target of Rho signalling (Jayo et al., 2012), Fascin-1 bundles parallel actin filaments, stabilising key migratory structures such as filopodia (Kureishy et al., 2002; Vignjevic et al., 2006; Pfisterer et al., 2020). BBS8 was not found in a complex with Fascin-1, and although Bbs8 was previously associated with focal adhesions and stress fibres similarly to Bbs6 (Hernandez- Hernandez et al., 2013), we did not see a defect in filopodia length upon loss of Bbs8. Our data further indicate a positive role for Fascin-1 in ciliogenesis. Although primary cilia are predominantly microtubule-based structures, actin related proteins have long been found to affect ciliogenesis. During the initial stages of ciliogenesis, many actin regulators, such as Arp2/3, focal adhesion kinase (FAK), vinculin, paxillin and Rho GTPases, are involved in the maturation of the mother centriole and positioning of the basal body (Brücker et al., 2020). In cycling cells, polymerised F-actin is associated with decreased ciliogenesis (Bershteyn et al., 2010; Kim et al., 2010, 2015; Liang et al., 2016). We were able to show that Fascin-1 joins the long list of actin-binding M-I 13 Publications & Manuscripts proteins regulating ciliogenesis. Loss of Fascin-1 reduced cilia numbers without affecting cilia length, suggesting a role for Fascin-1 in the initiation of ciliogenesis. Despite interaction between Fascin-1 and BBS6, we found that Fascin-1 acted antagonistically to Bbs6 on ciliogenesis, since the combined loss of both proteins rescued cilia numbers. BBS6 is a bona fide ciliary protein. It is part of a chaperonin-like complex essential for the initial assembly of the BBSome (Seo et al., 2010), a multiprotein complex required for ciliary trafficking (Nachury et al., 2007; Wei et al., 2012). Thus, depletion of Bbs6 correlates with a cell-type specific ciliation phenotype, reducing cilia numbers and length in RPE cells and tissue and enhancing both ciliation and ciliary length in kidney medullary cells (Patnaik et al., 2019; Volz et al., 2021). We have shown that loss of Bbs6 in MEFs enhanced cilia numbers, although the length was not affected. Since loss of Fascin-1 also resulted in a ciliary phenotype, it is possible that Fascin-1 is required for BBS6 function in chaperoning other important ciliary trafficking proteins. BBS6 also interacts with MACF1, an actin- and microtubule-binding protein involved in the docking of preciliary vesicles in the initial steps of ciliogenesis (May-Simera et al., 2016). Thus, the interaction between BBS6 and Fascin-1, similar to MACF1, might be also important for docking of preciliary vesicles during early ciliogenesis, a process that requires both a stable actin and microtubule network. It is further possible that the regulation of Fascin-1 in ciliogenesis might be facilitated via its interaction with Nesprin-2, an actin-binding protein at the outer nuclear lamina that was found to be important for precise trafficking of Arp2-dependent preciliary vesicles during centriole maturation (Jayo et al., 2016; Fan et al., 2020). Since actin proteins are highly involved in many steps of ciliogenesis, it is not surprising that F-actin itself and many actin regulators have recently been identified inside primary cilia (Nager et al., 2017; Phua et al., 2017; Kiesel et al., 2020). We were able to show that overexpressed Fascin-1 also localises to primary cilia albeit transiently, a finding supported by the studies of Phua and colleagues (Phua et al., 2017). Since one of the functions of F-actin inside cilia is thought to involve ectocytosis at the ciliary tip as a way of ciliary disassembly, it is plausible that Fascin-1 facilitates this process (Phua et al., 2017; Kiesel et al., 2020). However, we saw Fascin-1 localising along the complete axoneme and not accumulated at the ciliary tip. Besides regulating F-actin bundles, Fascin-1 is also able to bind to and regulate microtubules to control focal adhesion dynamics and speed of cell migration independently of its actin-binding function (Villari et al., 2015). This raises the possibility that the localisation of Fascin-1 inside primary cilia might be co-dependent on regulating both F-actin and microtubules, although we did not find an increase in ciliary Fascin-1 when introducing cytoskeletal mutants. Taken together, we identified Fascin-1 as a possible ciliary protein, localising transiently to primary cilia and contributing to cilia assembly. These data suggest that mutations in Fascin-1 might be associated with ciliopathies, an insinuation that is supported by findings of its second isoform, Fascin-2. M-I 14 Publications & Manuscripts The second isoform of Fascin, retinal Fascin-2, is highly homologous to Fascin-1 and has many characteristics that are reminiscent of other ciliopathy proteins. Fascin-2 localises to the inner and outer segment of photoreceptor cells (the outer segment being a highly specialised primary cilium) and actin-based stereocilia of the cochlea (Yokokura et al., 2005; Lin-Jones and Burnside, 2007; Perrin et al., 2013). Mutations in its gene fascin-2 are associated with retinopathies and progressive hearing loss due to shortened stereocilia bundles in mice (Yokokura et al., 2005; Perrin et al., 2013; Liu et al., 2018). There is also evidence that patient mutations in Fascin-2 lead to macular degeneration and cone dystrophy, both common ciliopathy phenotypes (Wada et al., 2003; Gui et al., 2018). These data raise the possibility that Fascin-2, and possibly its isoform Fascin-1, the focus of this paper, are bona fide ciliopathy proteins. Since there is still a certain percentage of ciliopathy patients with undiagnosed mutations, Fascin- 1 and Fascin-2 might be interesting candidates to screen in ciliopathy patients. Since we found loss of Fascin-1 resulting in reduced cilia assembly, we need to consider the downstream function of Fascin-1 in relation to ciliary dysfunction and actin dynamics. The signalling planar cell polarity (PCP) pathway, also referred to as the non-canonical Wnt signalling pathway, bridges ciliogenesis and actin networks. Upon activation of the PCP pathway, Frizzled receptor activation recruits Dishevelled to the plasma membrane via Inversin, where it activates formins such as Daam1 and Rho GTPases that consequently regulate downstream actin networks. BBS6 interacts with Inversin and facilitates its transport to the base of the cilium, activating non-canonical Wnt signalling (Patnaik et al., 2019). Consequently, Bbs6 is a positive regulator of non- canonical Wnt signalling (Gerdes et al., 2007; May-Simera et al., 2018; Patnaik et al., 2019; Volz et al., 2021). Concurrently, we showed that Bbs6 suppressed a downstream canonical Wnt target, Cyclin D1. Fascin-1 is also a negative regulator of Cyclin D1 transcription and nuclear localisation. We also showed that it interacts with the PCP effector protein Inversin, which is why we suppose that Fascin-1 acts in a complex with both BBS6 and Inversin in regulating Wnt signalling. While discussing the role of Fascin-1 in Wnt signalling, its regulation in cancer cell lines has to be considered, where canonical Wnt signalling is usually enhanced (Shang et al., 2017). In several cancer types, Fascin-1 seems to be a positive regulator of Wnt signalling, which is in contrast to our data. Knockdown of Fascin-1 in breast cancer cells reduced the expression of beta-catenin and Cyclin D1 via interaction with focal adhesion kinase (FAK), which consequently affects tumour cell growth (Barnawi et al., 2020). In the same cells, Fascin-1 was shown to interact with the non-canonical Wnt downstream target Daam1, promoting cancer cell migration (Hao et al., 2021). In human colorectal cancer, five putative TCF-binding sites in the untranslated region of the fascin-1 promoter have been identified, and the Fascin-1 gene is transactivated via TCF/LEF transcription factors that drive canonical Wnt signalling (Vignjevic et al., 2007). However, it has to be noted that the expression of Fascin-1 is naturally enhanced in cancer cell lines (Jayo and Parsons, 2010). Complicating things further, loss of Fascin-1 in melanoblasts was associated with less Cyclin D1 positive nuclei (Ma et al., 2013). Since we have shown that Fascin-1 is a negative regulator of M-I 15 Publications & Manuscripts canonical Wnt signalling in MEFs, we conclude that the role of Fascin-1 in Wnt signalling is highly cell-type specific. There is also evidence for Fascin-1 in the regulation of Wnt signalling via cytonemes, specialised signalling filopodia, that act as signalling hubs for the Wnt pathway in zebrafish and non-cancerous cell lines (Routledge and Scholpp, 2019). Downstream non-canonical PCP signalling controls the emergence of cytonemes which can then transport Wnt molecules to recipient cells, inducing canonical Wnt cascades (Stanganello et al., 2015; Mattes et al., 2018; Rosenbauer et al., 2020). Moreover, cytonemes can also distinguish between different types of signals and selectively grow in the direction of a preferred Wnt signal (Junyent et al., 2020). Hence, cytonemes are important for distribution and receiving of Wnt signals. Because Fascin-1 is required for cytoneme formation (Mattes and Scholpp, 2018; Junyent et al., 2020), these data depict an involvement of Fascin-1 in Wnt signalling of non-cancerous cells via regulation of cytonemes. Since we have shown a phenotype in filopodia length upon loss of Bbs6, it is feasible that Bbs6 is also involved in the sensing function of cytonemes and the concomitant distribution of Wnt signals from or to other cells together with Fascin-1. In the current work, we identified an association for Fascin-1 between ciliary proteins and actin-based filopodia sensing. We identified Fascin-1 as a bona fide ciliary protein since its loss led to a ciliary phenotype. We suggested that Fascin-1 is potentially involved in non-canonical Wnt/PCP signalling via its interaction with BBS6 and Inversin. Since PCP signalling affects filopodia formation, our data correlate ciliogenesis and associated PCP signalling with the observed filopodia phenotype in cilia mutant cells via Fascin-1. However, the mechanisms underlying ciliary function of Fascin-1, do not necessarily need to be the same as in filopodia. More research will help to understand the complex interplay between ciliogenesis, Wnt signalling and actin regulations, shedding light on how ciliopathies affect cellular homeostasis. Material and methods Cell culture Primary mutant and wildtype mouse embryonic fibroblasts (MEFs) were isolated at day E13.5 from Bbs6 null mice (Ross et al., 2005; Hernandez-Hernandez et al., 2013). Head and red organs were removed and remaining tissues trypsinized and dissociated first five times with a syringe followed by another five times dissociation with a 25µm needle. Cells were transferred into flasks and incubated in DMEM/F-12 (Thermofisher 31331093) supplemented with 1% P/ST (Thermofisher 10378016) and 10% FBS (Thermofisher 10270106). After reaching confluency, cells were immortalized according to the 3T3 immortalisation protocol (Reznikoff et al., 1973) and further cultured with constant passaging numbers. Bbs6 cells were regularly genotyped as previously described (Ross et al., 2005). 3T3 immortalised Bbs8 MEFs were a kind gift of the lab of Dagmar Wachten (Institute of Innate Immunity, Bonn) and isolated and M-I 16 Publications & Manuscripts cultivated in the same way as Bbs6 MEFs. For serum starvation (SS) experiments, cells were cultured for 24-48 h in OptiMEM (Thermofisher 11058021) prior harvest. For pulldown assays, HEK293T cells were obtained from ATCC and cultured in DMEM- Glutamax (Thermofisher 31966047) supplemented with 10% FBS and 1% P/ST. All cell lines were tested regularly for mycoplasma contamination. Transfections Plasmid transfection in HEK293T cells was conducted via Genetrap transfection reagent (made at NEI, NIH, Bethesda, MD, USA) as previously described (Patnaik et al., 2019). MEFs were transfected with Lipofectamine 2000 (Thermofisher; 11668030) according to the manufacturer’s instructions and fixed or imaged after 48 h. In case of serum starvation experiments, cells were first transfected for 24 h and serum starved for another 24 h prior to fixation and experiments. Knockdowns were performed via RNA interference with Lipofectamine RNAiMax transfection reagent (Thermo Fisher; 13778150) according to the manufacturer’s instructions. Mouse siRNAs for Fascin-1 (siFscn1) as well as non-targeting controls (siNTC) were obtained from IDT as Trifecta Kits (mm.Ri.Fscn1) and validated by RT-qPCR. Working concentration of each siRNA was 10nM. For siFscn1, siRNAs 3’-GAGACUUCUGGGUACUAUCAUUCGAAA-5’ and 3’-GACGAUGAAACUGUAGCUCACCACACU-5’ were used in combination. Validation of the knockdown is shown in Supp. Fig. 2. RNA isolation and RT-qPCR Total RNA was isolated from cells using TRIzol reagent (Thermo Fisher, 15596026) according to the manufacturer’s instructions. RNA concentration and purity were measured using the NanoDrop™ 2000c Spectrophotometer (Thermo Fisher). 1000 ng of total RNA was reverse transcribed into cDNA by GoScript Probe 2-step RT-qPCR system (Promega, A5000). Quantity of respective cDNAs was determined with a StepOnePlus™ Real-Time PCR System (Applied Biosystems, 4376600) using SYBR Green (Thermo Fisher; Platinum™ SYBR™ Green qPCR SuperMix-UDG, 11733046) according to the manufacturer’s recommendation. Cycling conditions were as follows: 95°C for 10 min followed by 40 cycles of 95°C for 15 s, 60°C for 1 min. Specificity of the amplified product was determined by melt curve analysis. Relative target gene expression (fold change) was normalized to Gapdh or Ywhaz (only in Bbs6 samples) and analysed by 2-ΔΔCT method. Live cell imaging MEFs were seeded at low confluency in imaging chambers (Ibidi, 80826) and transfected with RFP-Lifeact and EGFP-FSCN1 24 h post seeding. 48 h after transfection, Bbs6 cells were imaged with a Leica SP8 confocal microscope with photomultipliers and a HyD detector (Leica, Bensheim, Germany) at 63x M-I 17 Publications & Manuscripts magnification/1.40 oil (HC plan apochromat) under the conditions of 37°C supplied with 5% CO2. Videos of Bbs8 MEFs kept in an environmental chamber maintained at 37°C/5% CO2 were acquired on a Nikon A1R inverted laser scanning confocal microscope (Nikon Instruments UK) combined with a 60X Plan Fluore oil immersion objective (NA 1). Excitation wavelengths of 488 nm and 561 nm (diode lasers) were used. To follow their movement, cells coexpressing both RFP-Lifeact and EGFP- Fascin-1 were imaged every 5 sec for 30 timepoints. Videos were acquired either with the Leica LAS X (version 3.5.7.23225) or Nikon NIS-Elements (v4) imaging software. Videos were processed with Fiji/ImageJ software (NIH, Bethesda, USA) as tiff stacks and the length of each filopodium per cell was measurement with the FiloQuant plugin for Fiji as previously described (Jacquemet et al., 2019). Immunocytochemistry Cells were seeded on glass coverslips 24 h prior transfections or treatments. 48 h after knockdown or serum starvation experiments, cells were washed with sterile PBS. According to the antibody requirements, methanol fixation (100% ice cold methanol 10 min on ice) or paraformaldehyde (4% PFA 10 min at RT) fixation was used. Following PFA fixation, quenching was performed with 50mM NH4Cl for 10 min. Cells were permeabilized with PBSTx (PBS+0.3% TritonX) for 15 min and blocked with Fishblock blocking buffer (0.1% Ovalbumin, 0.5% Fish gelatine in PBS, 0.3% TritonX) for 1 h at RT. Primary antibodies were incubated in Fishblock over night at 4°C. Samples were washed three times 10 min with PBSTx and incubated with corresponding secondary antibodies for 1 h at RT. Samples were washed again twice with PBSTx and once with PBS before mounting coverslips on glass slides. Images were taken at RT either on a Leica SP8 confocal microscope with photomultipliers and HyD detector (HC plan apochromat 63x/1.4 oil CS2) or a Leica DM6000 microscope with a k5 sCMOS camera at 100x magnification/1.40 oil (Leica, Bensheim, Germany). Images showing filopodia were taken on a Zeiss LSM 900 with Airyscan 2 (63x/1.4 oil M27) (Carl Zeiss Microscopy, Jena, Germany). Processing, cilia length and fluorescence intensity measurements were all performed with Fiji/ImageJ software (NIH, Bethesda, USA). Antibodies For immunofluorescence, primary antibodies were used as follows: anti-FSCN1 (mm, 1:50; Invitrogen MA5-11483), anti-Arl13b (Rb, 1:800; Proteintech 17711-1-AP; mm, 1:200; Abcam N295B/66), anti-Actin (Rb, 1:200; Sigma A2066), anti-EGFP Living colors (Rb, 1:200; Takara Bio), anti-PCNT (1:500; Abcam Ab4448), anti-β-catenin (Rb, 1:200; Cell Signaling D10A8), anti-acetylated-β-catenin Lys49 (Rb, 1:150; Cell Signaling D7C2), anti-Cyclin D1 (Rb, 1:150; Cell Signaling E3P5S). Secondary antibodies used for immunofluorescence were DAPI (1:8000, Carl Roth 6843), Phalloidin TRITC (1:400, Sigma P1951), Phalloidin 647 (1:40, Cell Signal 8940), M-I 18 Publications & Manuscripts anti-mouse 488 (1:400, Invitrogen A21202), anti-mouse 555 (1:400, Invitrogen A31570), anti-rabbit 488 (1:400, Invitrogen A11034), anti-rabbit 555 (1:400, Invitrogen A21429). For western blotting, the following antibodies were used: anti-Myc (mm, 1:1000; BD Biosciences 611013), anti-GFP (Rb, 1:1000; Chromotek Pabg1-10), anti-RFP (Rb, 1:7000; Thermofisher R10367), anti-FSCN1 (mm, 1:1000; Invitrogen MA5-11483), anti-Gapdh (mm, 1:2000; Cell Signaling 97166), anti-Actin (Rb, 1:1000; Sigma A2066), anti-Cyclin D1 (Rb, 1:1000; Cell Signaling E3P5S), anti-GSK3beta (Rb, 1:1000; Abcam Ab15580), anti-β-catenin (Rb, 1:1000; Cell Signaling D10A8), anti-acetylated-β- catenin Lys49 (Rb, 1:1000; Cell Signaling D7C2), anti-Arl13b (Rb, 1:1000; Proteintech 17711-1-AP), anti-Gt335 (mm, 1:1000; Adipogen AG-20B-0020-C100), anti-Inversin (Rb, 1:1000; Proteintech 10585-1-AP), anti-Ubiquitin (Rb, 1:500; Sigma-Aldrich 07- 375) Secondary antibodies for western blotting were anti-rabbit 680nm (1:10,000, LI-COR Biosciences 925-68073), anti-rabbit 800nm (1:10,000, LI-COR Biosciences 926- 32211), anti-mouse 680nm (1:10,000, LI-COR Biosciences 925-68072), anti-mouse 800nm (1:10,000, LI-COR Biosciences 925-32212). Primers RT-qPCR Gene Forward Reverse mGapdh AATGGTGAAGGTCGGTGTGAA AGGTCAATGAAGGGGTCGTTG mYwhaz TCTTGATCCCCAATGCTTCG AATGCTTCTTGGTATGCTTGC mBbs6 GTGTGCTCTGCAAGATTTGG AAGACGTGCATTGCTGTTTG mInversin TCGCTGATGGAAACCTAACG AAGGAGATGGACAATCTGTGC mArl13b CTGGGATGTTCAGTCTGATGG TCTCCTTGGATTCCCTTTGC mFascin-1 GTTGGAATTCAATGACGGCG ACCTTGAGAGCCACCTTATTG mCyclind1 TGCCATCCATGCGGAAA AGCGGGAAGAACTCCTCTTC mmyc GCTGTTTGAAGGCTGGATTTC GATGAAATAGGGCTGTACGGAG mLrp5 GGGTCCACAAGGTCAAGGC GCACCCTCCATTTCCATCC mLrp6 GCCCACTACTCCCTGAATGCTG TGTGGATAGGAAGGATGATGTCAGG mDvl2 GGCTTGTGTCGTCAGATACC TTTCATGGCTGCTGGATAC mDvl3 CCGATGAGGATGATTCCACC TGAGGCACTGCTCTGTTCTG mAxin2 GAGTAGCGCCGTGTTAGTGACT CCAGGAAAGTCCGGAAGAGGTATG mβ-catenin GTGCAATTCCTGAGCTGACA CTTAAAGATGGCCAGCAAGC mLef1 GTCCCTTTCTCCACCCATC AAGTGCTCGTCGCTGTAG mβ-actin CACAGCTGAGAGGGAAATCGTGC GATCTTGATCTTCATGGTGCTAGG Pulldown assays and western blotting For interaction studies, HEK293T cells were co-transfected with EGFP-FSCN1, mRFP-FSCN1, EGFP-INVS, pCMV-MYC-BBS8 or pCMV-MYC-BBS6 or empty vector M-I 19 Publications & Manuscripts controls using Genetrap as described above. After 48 h, cells were lysed in RIPA buffer (50 mM Tris-HCl pH 8, 150 mM NaCl, 1% NP-40, 0.5% Sodiumdeoxycholate, 0.1% SDS) containing Halt™ Protease and Phosphatase Inhibitor Cocktail (100X, Thermo Fisher 78442). Pulldowns for EGFP were performed with magnetic agarose beads (GFP-Trap-MA, ChromoTek) according to the manufacturer’s instructions. Proteins were washed off the beads with 1X Laemmli loading buffer containing SDS, DTT and beta-mercaptoethanol at 95°C for 10 min. For co-immunoprecipitations of Fascin-1 and Ubiquitin, MEFs were treated with MG132 (10µM; Calbiochem 474791) for 5 h before lysates were prepared as described above. Immunoprecipitations were carried out with 12.5 µl Dynabeads Protein-G (Fisher Scientific, 10003D) per sample, washed with 500 µl PBSTx (0.01% TritonX) and incubated for 4 h at 4°C with 6 µl Fascin antibody (mm, Invitrogen MA5-11483) or mouse IgG control during rotation. Lysates were incubated rotating on antibody coated beads overnight at 4°C. Beads were washed 3 times with PBSTx and proteins were eluted with 1X Laemmli buffer without DTT and beta-mercaptoethanol at 95°C for 10 min. Before loading on gel, DTT and beta- mercaptoethanol was added again to avoid protein aggregates. Proteins were separated on 10% polyacrylamide gels via SDS-PAGE followed by western blotting. Proteins were transferred onto PVDF membranes (Immobilon®-FL PVDF membrane, Sigma, 05317) and blocked with Applichem blocking buffer (0.2% AppliChem Blocking Reagent, 10 mM TrisHCl, 150 mM NaCl, 0.04% NaN3; pH 7.4) or 5% milk or 5% BSA blocking according to the antibody’s requirement. Membranes were probed with antibodies over night at 4°C, washed with TBS 0.1% Tween and incubated with corresponding secondary antibodies for 1 h at RT. Scanning was performed in the Odyssey Infrared Imaging System (Licor) at 680 or 800 nm. Densitometry analysis (AUC) was performed with Fiji/ImageJ software (NIH, Bethesda, MD, USA) and the expression levels were normalised to the inputs or Gapdh expression level. Statistical analysis Statistical analysis was performed using IBM SPSS 27 software (IBM, NY, USA). Parametric or non-parametric data distribution was determined using Shapiro-Wilk test and outliers were extracted. Parametric differences were determined using t-test. Differences between two non-parametric groups were compared using a Mann- Whitney-U/Wilcoxon signed-rank test. P-values of 0.05 and below were considered statistically significant. Statistical tests and number of repetitions are described in the legends. Boxplots show median (middle line), edge of boxes is top and bottom quartiles (25–75%), and whiskers represent the ranges for the upper 25% and the bottom 25% of data values. Outliers are shown as circles above and below whiskers. Bar plots show mean ± standard errors (SE). M-I 20 Publications & Manuscripts Acknowledgements The authors would like to thank Petra Gottlöber, Ursula Göringer-Struwe and Dominik Reichert for their technical support. We also thank Søren T. Christensen, Ann-Kathrin Volz and Matthias Brust for abundant discussion and assistance. We would also like to acknowledge the unwavering commitment of the Imaging Core Facility and Prof. Dr. Krishnaraj Rajalingam that made this research possible. Funding This work was supported by the Johannes Gutenberg University of Mainz, the Alexander von Humboldt Foundation (Sofja Kovalevskaja Award) and the Hanns Seidel and Sibylle Kalkhof-Rose Foundations. Declaration of interest The authors have no competing interest to declare. References Amarachintha, S.P. et al. (2015). Effect of Cdc42 domains on filopodia sensing, cell orientation, and haptotaxis. Cell. Signal. 27, 683–693. Antonellis, P.J. et al. (2014). ACF7 Is a hair-bundle antecedent, positioned to integrate cuticular plate actin and somatic tubulin. J. Neurosci. 34, 305–312. Balmer, S. et al. (2015). Components of Intraflagellar Transport Complex A Function Independently of the Cilium to Regulate Canonical Wnt Signaling in Drosophila. Dev. Cell 34, 705–718. Barnawi, R. et al. (2020). Fascin Activates β-Catenin Signaling and Promotes Breast Cancer Stem Cell Function Mainly Through Focal Adhesion Kinase (FAK): Relation With Disease Progression. Front. Oncol. 10, 440. Bershteyn, M. et al. (2010). MIM and cortactin antagonism regulates ciliogenesis and hedgehog signaling. Dev. Cell 19, 270–283. Brücker, L. et al. (2020). The entangled relationship between cilia and actin. Int. J. Biochem. Cell Biol. 129, 105877. Chen, H.Y. et al. (2021). Primary cilia biogenesis and associated retinal ciliopathies. Semin. Cell Dev. Biol. 110, 70–88. Copeland, S.J. et al. (2018). Actin-dependent regulation of cilia length by the inverted formin FHDC1. Mol. Biol. Cell 29, 1611–1627. Corbit, K.C. et al. (2008). Kif3a constrains β-catenin-dependent Wnt signalling through dual ciliary and non-ciliary mechanisms. Nat. Cell Biol. 10, 70–76. M-I 21 Publications & Manuscripts Cui, C. et al. (2013). Wdpcp, a PCP Protein Required for Ciliogenesis, Regulates Directional Cell Migration and Cell Polarity by Direct Modulation of the Actin Cytoskeleton. PLoS Biol. 11, e1001720. Fan, J. et al. (2020). Lamin A‐mediated nuclear lamina integrity is required for proper ciliogenesis. EMBO Rep. 21. Gerdes, J.M. et al. (2007). Disruption of the basal body compromises proteasomal function and perturbs intracellular Wnt response. Nat. Genet. 39, 1350–1360. Goetz, S.C., and Anderson, K. V (2010). The primary cilium: a signalling centre during vertebrate development. Nat. Rev. Genet. 11, 331–344. Gui, W. et al. (2018). Novel Cone Dystrophy With Central Ellipsoid Zone Loss Associated With Human Retinal Fascin Gene (FSCN2) Mutation. Retin. Cases Brief Rep. 12, 63–66. Habas, R. et al. (2001). Wnt/Frizzled activation of Rho regulates vertebrate gastrulation and requires a novel formin homology protein Daam1. Cell 107, 843–854. Hao, L. et al. (2021). Formin homology domains of Daam1 bind to Fascin and collaboratively promote pseudopodia formation and cell migration in breast cancer. Cell Prolif. 54. Hernandez-Hernandez, V. et al. (2013). Bardet-biedl syndrome proteins control the cilia length through regulation of actin polymerization. Hum. Mol. Genet. 22, 3858– 3868. Jacquemet, G. et al. (2019). Filopodia quantification using filoquant. In: Methods in Molecular Biology, Humana Press Inc., 359–373. Jayo, A. et al. (2012). A novel Rho-dependent pathway that drives interaction of fascin- 1 with p-Lin-11/Isl-1/Mec-3 kinase (LIMK) 1/2 to promote fascin-1/actin binding and filopodia stability. BMC Biol. 10, 72. Jayo, A. et al. (2016). Fascin Regulates Nuclear Movement and Deformation in Migrating Cells. Dev. Cell 38, 371–383. Jayo, A., and Parsons, M. (2010). Fascin: A key regulator of cytoskeletal dynamics. Int. J. Biochem. Cell Biol. 42, 1614–1617. Junyent, S. et al. (2020). Specialized cytonemes induce self-organization of stem cells. Proc. Natl. Acad. Sci. U. S. A. 117, 7236–7244. Kiesel, P. et al. (2020). The molecular structure of mammalian primary cilia revealed by cryo-electron tomography. Nat. Struct. Mol. Biol. 1–10. Kim, J. et al. (2010). Functional genomic screen for modulators of ciliogenesis and cilium length. Nature 464, 1048–1051. Kim, J. et al. (2015). Actin remodelling factors control ciliogenesis by regulating YAP/TAZ activity and vesicle trafficking. Nat. Commun. 6, 6781. Kim, J.C. et al. (2005). MKKS/BBS6, a divergent chaperonin-like protein linked to the obesity disorder Bardet-Biedl syndrome, is a novel centrosomal component required for cytokinesis. J. Cell Sci. 118, 1007–1020. M-I 22 Publications & Manuscripts Kureishy, N. et al. (2002). Fascins, and their roles in cell structure and function. BioEssays 24, 350–361. Lee, K.H. (2020). Involvement of Wnt signaling in primary cilia assembly and disassembly. FEBS J. 287, 5027–5038. Liang, Y. et al. (2016). Mechanism of ciliary disassembly. Cell. Mol. Life Sci. 73, 1787– 1802. Lienkamp, S. et al. (2012). Inversin, Wnt signaling and primary cilia. Differentiation 83, S49–S55. Lin-Jones, J., and Burnside, B. (2007). Retina-specific protein fascin 2 is an actin cross-linker associated with actin bundles in photoreceptor inner segments and calycal processes. Investig. Ophthalmol. Vis. Sci. 48, 1380–1388. Lin, S. et al. (2016). Monoubiquitination inhibits the actin bundling activity of fascin. J. Biol. Chem. 291, 27323–27333. Liu, W. et al. (2008). Mechanism of activation of the Formin protein Daam1. Proc. Natl. Acad. Sci. U. S. A. 105, 210–215. Liu, X. et al. (2018). Null mutation of the Fascin2 Gene by TALEN leading to progressive hearing loss and retinal degeneration in C57BL/6J mice. G3 Genes, Genomes, Genet. 8, 3221–3230. Ma, Y. et al. (2013). Fascin 1 is transiently expressed in mouse melanoblasts during development and promotes migration and proliferation. Dev. 140, 2203–2211. Mattes, B. et al. (2018). Wnt/PCP controls spreading of Wnt/β-catenin signals by cytonemes in vertebrates. Elife 7, e36953. Mattes, B., and Scholpp, S. (2018). Emerging role of contact-mediated cell communication in tissue development and diseases. Histochem. Cell Biol. 150, 431– 442. May-Simera, H.L. et al. (2010). Bbs8, together with the planar cell polarity protein Vangl2, is required to establish left-right asymmetry in zebrafish. Dev. Biol. 345, 215– 225. May-Simera, H.L. et al. (2015). Ciliary proteins Bbs8 and Ift20 promote planar cell polarity in the cochlea. Development 142, 555–566. May-Simera, H.L. et al. (2016). Loss of MACF1 Abolishes Ciliogenesis and Disrupts Apicobasal Polarity Establishment in the Retina. Cell Rep. 17, 1399–1413. May-Simera, H.L. et al. (2018). Primary Cilium Mediated Retinal Pigment Epithelium Maturation is Retarded in Ciliopathy Patient Cells. CellReports 22, 189–205. May-Simera, H.L., and Kelley, M.W. (2012). Cilia, Wnt signaling, and the cytoskeleton. Cilia 1, 7. McMurray, R.J. et al. (2013). Surface topography regulates wnt signaling through control of primary cilia structure in mesenchymal stem cells. Sci. Rep. 3, 3545. Nachury, M. V. et al. (2007). A Core Complex of BBS Proteins Cooperates with the GTPase Rab8 to Promote Ciliary Membrane Biogenesis. Cell 129, 1201–1213. M-I 23 Publications & Manuscripts Nager, A.R. et al. (2017). An Actin Network Dispatches Ciliary GPCRs into Extracellular Vesicles to Modulate Signaling. Cell 168, 252–263. Novas, R. et al. (2015). Bardet-Biedl syndrome: Is it only cilia dysfunction? FEBS Lett. 589, 3479–3491. Nozaki, S. et al. (2019). Requirement of IFT-B–BBSome complex interaction in export of GPR161 from cilia. Biol. Open 8. Patnaik, S.R. et al. (2019). Bardet–Biedl Syndrome proteins regulate cilia disassembly during tissue maturation. Cell. Mol. Life Sci. 76, 757–775. Perrin, B.J. et al. (2013). β-actin and fascin-2 cooperate to maintain stereocilia length. J. Neurosci. 33, 8114–8121. Pfisterer, K. et al. (2020). FMNL2 regulates dynamics of fascin in filopodia. J. Cell Biol. 219. Phua, S.C. et al. (2017). Dynamic Remodeling of Membrane Composition Drives Cell Cycle through Primary Cilia Excision. Cell 168, 264–279. Pitaval, A. et al. (2010). Cell shape and contractility regulate ciliogenesis in cell cycle- arrested cells. J. Cell Biol. 191, 303–312. Reiter, J.F., and Leroux, M.R. (2017). Genes and molecular pathways underpinning ciliopathies. Nat. Rev. Mol. Cell Biol. 18, 533–547. Reznikoff, C.A. et al. (1973). Establishment and characterization of a cloned line of C3H mouse embryo cells sensitive to postconfluence inhibition of division. Cancer Res. 33. Rosenbauer, J. et al. (2020). Modeling of wnt-mediated tissue patterning in vertebrate embryogenesis. PLoS Comput. Biol. 16. Ross, A.J. et al. (2005). Disruption of Bardet-Biedl syndrome ciliary proteins perturbs planar cell polarity in vertebrates. Nat. Genet. 37, 1135–1140. Routledge, D., and Scholpp, S. (2019). Mechanisms of intercellular wnt transport. Dev. 146. Seo, S. et al. (2010). BBS6, BBS10, and BBS12 form a complex with CCT/TRiC family chaperonins and mediate BBSome assembly. Proc. Natl. Acad. Sci. 107, 1488–1493. Shang, S. et al. (2017). The regulation of β-catenin activity and function in cancer: Therapeutic opportunities. Oncotarget 8, 33972–33989. Shinde, S.R. et al. (2020). Ubiquitin chains earmark GPCRs for BBSome-mediated removal from cilia. J. Cell Biol. 219. Shtutman, M. et al. (1999). The cyclin D1 gene is a target of the β-catenin/LEF-1 pathway. Proc. Natl. Acad. Sci. U. S. A. 96, 5522–5527. Simons, M. et al. (2005). Inversin, the gene product mutated in nephronophthisis type II, functions as a molecular switch between Wnt signaling pathways. Nat. Genet. 37, 537–543. Smith, C.E.L. et al. (2020). Primary Cilia, Ciliogenesis and the Actin Cytoskeleton: A Little Less Resorption, A Little More Actin Please. Front. Cell Dev. Biol. 8, 622822. M-I 24 Publications & Manuscripts Stanganello, E. et al. (2015). Filopodia-based Wnt transport during vertebrate tissue patterning. Nat. Commun. 6, 5846. Tetsu, O., and McCormick, F. (1999). β-catenin regulates expression of cyclin D1 in colon carcinoma cells. Nature 398, 422–426. Thurston, S.F. et al. (2012). The Ability to Induce Microtubule Acetylation Is a General Feature of Formin Proteins. PLoS One 7, e48041. Tobin, J.L. et al. (2008). Inhibition of neural crest migration underlies craniofacial dysmorphology and Hirschsprung’s disease in Bardet-Biedl syndrome. Proc. Natl. Acad. Sci. U. S. A. 105, 6714–6719. Veland, I.R. et al. (2013). Inversin/Nephrocystin-2 Is Required for Fibroblast Polarity and Directional Cell Migration. PLoS One 8. Vignjevic, D. et al. (2006). Role of fascin in filopodial protrusion. J. Cell Biol. 174, 863– 875. Vignjevic, D. et al. (2007). Fascin, a novel target of β-catenin-TCF signaling, is expressed at the invasive front of human colon cancer. Cancer Res. 67, 6844–6853. Villari, G. et al. (2015). A direct interaction between fascin and microtubules contributes to adhesion dynamics and cell migration. J. Cell Sci. 128, 4601–4614. Volz, A.K. et al. (2021). Bardet-Biedl syndrome proteins modulate the release of bioactive extracellular vesicles. Nat. Commun. 12. Wada, Y. et al. (2003). Autosomal Dominant Macular Degeneration Associated With 208delG Mutation in the FSCN2 Gene. Arch. Ophthalmol. 121, 1613–1620. Wallingford, J.B., and Mitchell, B. (2011). Strange as it may seem: The many links between Wnt signaling, planar cell polarity, and cilia. Genes Dev. 25, 201–213. Wang, Y. et al. (2017). Planar cell polarity effector fritz interacts with dishevelled and has multiple functions in regulating PCP. G3 Genes, Genomes, Genet. 7, 1323–1337. Wei, Q. et al. (2012). The BBSome controls IFT assembly and turnaround in cilia. Nat. Cell Biol. 14, 950–957. Werner, M.E. et al. (2013). Inversin modulates the cortical actin network during mitosis. Am. J. Physiol. - Cell Physiol. 305, 36–47. Wolf, D. et al. (2002). Acetylation of β-catenin by CREB-binding protein (CBP). J. Biol. Chem. 277, 25562–25567. Wu, X. et al. (2008). ACF7 Regulates Cytoskeletal-Focal Adhesion Dynamics and Migration and Has ATPase Activity. Cell 135, 137–148. Xu, Q. et al. (2015). BBS4 and BBS5 show functional redundancy in the BBSome to regulate the degradative sorting of ciliary sensory receptors. Sci. Rep. 5, 1–16. Yin, Y. et al. (2009). The Talpid3 gene (KIAA0586) encodes a centrosomal protein that is essential for primary cilia formation. Development 136, 655–664. Yokokura, S. et al. (2005). Targeted disruption of FSCN2 gene induces retinopathy in mice. Investig. Ophthalmol. Vis. Sci. 46, 2905–2915. M-I 25 Publications & Manuscripts Young, K.G. et al. (2008). INF1 is a novel microtubule-associated formin. Mol. Biol. Cell 19, 5168–5180. Supplementary figures Supp. Fig. 1: Bbs8 does not affect filopodia dynamics. A Live cell imaging of Bbs8 MEFs overexpressing Lifeact for the actin cytoskeleton and EGFP-FSCN1 as a filopodia marker. Images represent one timepoint out of 30, videos are shown in supplementary videos 3 and 4. B Average filopodia length via FiloQuant analysis shows no significant difference in filopodia length upon Bbs8 knockout (Mann-Whitney-U test p=0.74). N(Bbs8+/+)=18, N(Bbs8-/-)=16. Experiments were repeated twice. C Interaction study between Fascin-1 and BBS6/BBS8. GFP pulldowns were performed 48 h after overexpression of EGFP-FSCN1 and MYC-BBS6 or MYC-BBS8 in HEK293T cells. The interaction between EGFP-INVS (Inversin) and MYC-BBS6 was used as positive control, EGFP-empty served as negative control. MYC-BBS8 did not form a complex with EGFP- FSCN1. Red box shows positive interaction between EGFP-FSCN1 and MYC-BBS6 as shown in figure 1. M-I 26 Publications & Manuscripts Supp. Fig. 2: Validation of Fascin-1 knockdown in mouse embryonic fibroblasts. A mRNA level of Fascin-1 (2-ΔΔCT) in MEFs 48 h after knockdown measured by RT-qPCR. mRNA expression of Fascin-1 is significantly reduced to ~11% after knockdown in comparison to siNTC. N=3. B mRNA level of Fascin-1 (2-ΔΔCT) in Bbs6 wildtype and knockout MEFs 48 h after knockdown measured by RT-qPCR shows a successful reduction in mRNA of Fascin-1 in both cell lines. N=3. C Protein expression of Fascin-1 in MEFs validated by western blot is reduced to 26% after knockdown of Fascin- 1. Numbers show AUC for protein bands in relation to Gapdh and normalised to siNTC (fold change). D Visualisation of Fascin-1 (red) via endogenous immunofluorescence staining in MEFs reveals less signal for Fascin-1 after Fascin-1 knockdown. M-I 27 Publications & Manuscripts Supp. Fig. 3: Bbs6 does not affect ubiquitination of Fascin-1. Immunoprecipitation of endogenous Fascin-1 of Bbs6+/+ and Bbs6-/- MEFs with or without treatment of MG132 (5 h). Probing the membranes with Ubiquitin antibody reveals no differences between level of ubiquitinated Fascin-1 (red box) in Bbs6 wildtype or knockout cells. N=2. M-I 28 Publications & Manuscripts Supp. Fig. 4: Localisation of EGFP-tagged Fascin-1 mutations in MEFs. Overexpression of EGFP-tagged FSCN1 variants (green) and costaining with cilia markers PCNT (basal body) and Arl13b (cilia membrane; both red) 48 h after transfection in serum-depleted MEFs shows no improvement of ciliary localisation of the different mutations. Scale bars of magnified images: 3µm. M-I 29 Publications & Manuscripts Publication III 23 International Journal of Biochemistry and Cell Biology 129 (2020) 105877 Contents lists available at ScienceDirect International Journal of Biochemistry and Cell Biology journal homepage: www.elsevier.com/locate/biocel Review article The entangled relationship between cilia and actin Lena Brücker, Viola Kretschmer, Helen Louise May-Simera * Cilia Cell Biology, Institute of Molecular Physiology, Johannes-Gutenberg University, Mainz, Germany A R T I C L E I N F O A B S T R A C T Keywords: Primary cilia are microtubule-based sensory cell organelles that are vital for tissue and organ development. They Actin act as an antenna, receiving and transducing signals, enabling communication between cells. Defects in cilio- Cilia genesis result in severe genetic disorders collectively termed ciliopathies. In recent years, the importance of the PCP direct and indirect involvement of actin regulators in ciliogenesis came into focus as it was shown that F-actin Signalling Ciliopathies polymerisation impacts ciliation. The ciliary basal body was further identified as both a microtubule and actin organising centre. In the current review, we summarize recent studies on F-actin in and around primary cilia, focusing on different actin regulators and their effect on ciliogenesis, from the initial steps of basal body posi- tioning and regulation of ciliary assembly and disassembly. Since primary cilia are also involved in several intracellular signalling pathways such as planar cell polarity (PCP), subsequently affecting actin rearrangements, the multiple effectors of this pathway are highlighted in more detail with a focus on the feedback loops con- necting actin networks and cilia proteins. Finally, we elucidate the role of actin regulators in the development of ciliopathy symptoms and cancer. 1. Introduction ciliated cells, the basal body represents the microtubule organising centre (MTOC) of the cell as it nucleates and anchors microtubules Primary cilia are microtubule-based cellular membrane protrusions (Delgehyr et al., 2005). Nine microtubule doublets extend from the basal that are important for signalling and communication within numerous body into the ciliary axoneme. The cilium is built, maintained and cells and tissue types. Over the last two decades, it has been shown that subsequently disassembled via intraflagellar transport (IFT), a cargo primary cilia defects underlie several genetic disorders, collectively machinery that transports proteins into and out of the cilium (Ishikawa referred to as ciliopathies. Until now, more than 20 syndromic cil- and Marshall, 2017; Kozminski et al., 1993). iopathies such as Bardet-Biedl syndrome (BBS), Meckel-Gruber syn- Historically, primary or sensory cilia, occurring solitary per cell, drome (MKS), Joubert syndrome (JS), McKusick-Kaufman syndrome were thought to be strictly separable from motile cilia, of which there (MKKS) or Nephronophthisis (NPHP) have been described, sharing can be multiple per cell, and which are required for fluid transport over multiple overlapping phenotypes such as retinopathies, kidney cysts, membrane surfaces (Lee, 2011). This initial distinction stems from obesity or polydactyly (Forsythe et al., 2018; Fraser and Davey, 2019; structural differences between primary and motile cilia. However, Hartill et al., 2017; Praveen et al., 2015; Slavotinek and Biesecker, 2000; recent data indicate that motile cilia also execute sensory functions Srivastava et al., 2018). Non-syndromic ciliopathies in which only one (Bloodgood, 2010; Jain et al., 2012; Shah et al., 2009). organ or tissue type is affected, for example polycystic kidney disease Although primary cilia are predominantly microtubule-associated (PKD) or retinitis pigmentosa (RP), are more common (Bergmann, 2015; structures, recent studies implicate a prominent role for F-actin and Estrada-Cuzcano et al., 2012). actin-associated proteins in cilia processes. Filamentous actin (F-actin) is The overall structure of a primary cilium consists of the basal body, composed of polarised globular G-actin monomers that aggregate and derived from the mother centriole, which anchors the cilium inside the twist around each other to form stable F-actin filaments (Dominguez and cell, and the ciliary axoneme (Fig. 1). The basal body, embedded in a Holmes, 2011). These F-actin filaments were found to play important cloud of pericentriolar material (PCM), is composed of nine microtubule roles in many cellular processes as their rearrangement is tightly con- triplets connected to the intracellular microtubule cytoskeleton via nected to cell cycle and cell migration. The current review will focus on subdistal appendages (Delgehyr et al., 2005; Tateishi et al., 2013). In recent research investigating the involvement of F-actin during * Corresponding author. E-mail address: may-simera@uni-mainz.de (H.L. May-Simera). https://doi.org/10.1016/j.biocel.2020.105877 Received 25 August 2020; Received in revised form 23 October 2020; Accepted 26 October 2020 Available online 7 November 2020 1357-2725/© 2020 Published by Elsevier Ltd. L. Brücker et al. I n t e r n a t i o n a l J o u r n a l o f B i o c h e m i s t r y a n d C e l l B i o l o g y 129 (2020) 105877 ciliogenesis, disassembly and its contribution to ciliopathy phenotypes interaction and recruitment of Rab GTPases such as Rab11, Rabin8 and and cancer. the small GTPase Rab8, which are commonly known for actin regulation (Wu et al., 2018). Rab GTPases in general play a prominent role in 2. Actin during ciliogenesis centriole maturation as reviewed in Blacque et al. (2018). After docking of preciliary vesicles at the mother centriole, distal Ciliogenesis is a highly complex process that can either occur via an appendage vesicles fuse to form the ciliary vesicle, a process involving extracellular pathway in which initiation begins at the cell surface or an membrane tubulation (Lu et al., 2015). This remodelling of the distal intracellular pathway starting within the cytoplasm (Wang and Dyn- ends of the mother centriole results in the extension of axonemal lacht, 2018). Most research has focused on the intracellular pathway, microtubule doublets. This nascent primary cilium docks at the plasma which requires several different proteins during centriole maturation, membrane via its distal appendages where it is anchored to the intra- basal body docking and subsequent axonemal growth, with F-actin cellular microtubule network via subdistal appendages (Huang et al., being involved in many of these processes. 2017). In addition, focal adhesion complexes including proteins such as As cells exit the cell cycle, the mother centriole undergoes matura- focal adhesion kinase (FAK), vinculin and paxillin connect the basal tion to initiate cilia formation. During this process, small preciliary body to the actin cytoskeleton (Antoniades et al., 2014). During vesicles, originating from the Golgi and endosome, are transported along centrosome positioning and basal body docking, a RhoA-dependent microtubules and dock at the distal appendages of the mother centriole apical network is formed (Pan et al., 2007). Nesprin-2, an (Schmidt et al., 2012; Wu et al., 2018). The transport and subsequent actin-binding protein at the outer-nuclear membrane, was shown to docking events of preciliary vesicles are particularly dependent on an regulate centriole migration and positioning through remodelling of intact F-actin network and the actin-dependent motor proteins myosin RhoA-dependent actin networks via interaction with the transmembrane Va and myosin heavy chain 10 (Hong et al., 2015; Wu et al., 2018). cilia protein MKS3 (Meckel-Gruber syndrome 3) (Dawe et al., 2009). Hereby, actin filament nucleation is initiated via the actin nucleator Besides Arp2/3, the actin nucleator Cobl (Cordon-Bleu) was further complex Arp2/3, which is recruited via pericentriolar material-1 shown to be critical for centrosome positioning (Haag et al., 2018). After (PCM-1) (Farina et al., 2016; Obino et al., 2016). This involves the docking at the plasma membrane, distal appendages recruit further Fig. 1. Ciliary actin localisation. Top left: The immunofluores- cence image shows a primary cilium visualised via Arl13b, which labels the ciliary axoneme (red), and the actin cytoskeleton (green) in mouse embryonic fibroblasts. Scale bar: 10 μm. Actin filaments (red) are found at the ciliary pocket, an evagination of the plasma membrane at the base of the cilium (Saito et al., 2017). An Arp2/3 branched actin network is also found around the basal body (Farina et al., 2016; Molla-Herman et al., 2010). F-actin was further visualised in the ciliary axoneme (Copeland et al., 2018; Kiesel et al., 2020; Lee et al., 2018; Phua et al., 2017) and at the ciliary tip, where it is involved in cilia decapitation via ectocytosis (Corral-serrano et al., 2020; Nager et al., 2017; Phua et al., 2017; Wang, Hu et al., 2019). Actin and the actin regulator WASF3 get recruited via PCARE into the cilium to enable ectocytosis, which further involves actin regulators Drebrin, Myosin VI and Rab7. The phospholipid PI(4,5)P2 recruits Cofilin-1, Fascin and Kras inside the cilium to support actin-based ciliary ectocytosis. PCARE: Photoreceptor Cilium Actin Regulator, WASF3: Wiskott-Aldrich Syndrome Protein Family Member 3, FHDC1: FH2 Domain Con- taining 1/Inverted Formin-1, Arp2/3: Actin Related Protein2/3, PI (4,5)P2: Phosphatidylinositol 4,5-bisphosphate. 2 L. Brücker et al. I n t e r n a t i o n a l J o u r n a l o f B i o c h e m i s t r y a n d C e l l B i o l o g y 129 (2020) 105877 components of the intraflagellar transport (IFT) machinery to the cilium, able to visualise F-actin inside cilia of cultured mammalian IMCD3 cells which are, besides their role in diffusion of tubulin molecules, required upon maximising microscope intensity (Lee et al., 2018). In concordance for subsequent elongation of axonemal microtubules (Harris et al., 2020; with this, a recent landmark study by Kiesel et al. was finally able to Yang et al., 2018). A complex of several proteins named the BBSome, identify filamentous actin inside the axonemes of primary cilia in mutations in which cause the ciliopathy Bardet-Biedl syndrome, is MDCK-II cells using both cryo-electron and confocal microscopy (Kiesel responsible for assembling IFT complexes with their cargos in order to et al., 2020). In support of both studies, ciliary proteomic studies have build and maintain cilia by trafficking of tubulin and signalling mole- identified several actin-associated proteins (Ishikawa et al., 2012; Kim cules (Blacque et al., 2004; Wei et al., 2012). Following basal body et al., 2010; Kohli et al., 2017; Mick et al., 2015). However, only two docking, the ciliary pocket is formed via membrane remodelling which studies have actually focused on these findings in a proteomic screen of is also driven by actin proteins (Saito et al., 2017). the ciliary membrane (Kohli et al., 2017) and in a siRNA-based genomic The initiation of ciliogenesis and centrosome positioning requires screen (Kim et al., 2010). both a stable actin and microtubule network (Pitaval et al., 2017, 2010). More recently, studies examining a role for actin in cilia have focused Therefore, proteins regulating both networks have recently been on its potential function during cilia decapitation. The process of cilia investigated in relations to ciliogenesis. The inverted formin-1 (FHDC1) decapitation or shedding via ectocytosis of extracellular vesicles, so- is one of the only mammalian formins affecting early ciliogenesis via called ectosomes, represents an alternative actin-dependent cilia disas- interaction with subdistal appendage protein Cep170 (Copeland et al., sembly mechanism as well as an alternative method for removing ciliary 2018). Unlike other formins, known to nucleate actin, FHDC1 also components (Mirvis et al., 2019; Phua et al., 2017; Wang and Barr, functions in microtubule stabilisation and acetylation via its FH1-FH2 2018). domain (Thurston et al., 2012; Young et al., 2008). Due to this com- The process of ectocytosis can be reconstructed in the outer segments bined regulation of actin and microtubules and its interaction with of photoreceptor cells which represent highly specialised primary cilia. Cep170, depletion of FHDC1 resulted in inhibition of ciliogenesis, In rds mutant mice, disc formation is inhibited due to a lack of the whereas overexpression lead to defects in ciliary disassembly and protein peripherin which means that the evaginating membrane is shed accumulation of F-actin inside cilia (Copeland et al., 2018). Another in form of ectosomes (Connell et al., 1991; Salinas et al., 2017; Travis protein regulating both actin and microtubule dynamics is the micro- et al., 1991). This phenotype is common in other cilia mutant photore- tubule actin crosslinking factor 1 (MACF1), which has been shown to be ceptors and represents a good example for studying proteins involved in involved in the early stages of ciliogenesis. MACF1 facilitates microtu- ciliary membrane evagination (Dilan et al., 2018). Proteomic investi- bule organisation at focal adhesions and stabilises F-actin (Antonellis gation of these abnormally released ectosomes identified actin regula- et al., 2014; Wu et al., 2008). Deletion of MACF1 leads to increased actin tors such as C2orf71/PCARE, WASF3 and members of the Arp2/3 stress fibre formation and loss of microtubule anchoring which con- complex, indicating the involvement of these proteins in ciliary ecto- cludes in failed basal body docking of ciliary vesicles (May-Simera et al., cytosis (Spencer et al., 2019). 2016). MACF1 was further shown to interact with the ciliopathy protein Furthermore, actin regulators drebrin and myosin VI have been BBS6 and Talpid3, a protein that is important for recruiting the small shown to localise to the ciliary tip in cultured mammalian IMCD3 cells GTPase Rab8 during preciliary vesicle docking (Kobayashi et al., 2014; pointing to a role of actin at the site of cilia decapitation (Nager et al., May-Simera et al., 2016; Wang et al., 2016). Interestingly, loss of Tal- 2017, see Fig. 1). Drebrin and myosin VI were shown to mediate the pid3 disorganises actin networks and more recently, it has been shown ectosomal release of ciliary G-protein coupled receptors (GPCRs) at the to regulate the assembly of subdistal appendages (Wang et al., 2018). ciliary tip upon failed ‘normal’ BBSome-dependent retrieval out of the The acetylation of microtubules in the ciliary axoneme is mainly cilium (Nager et al., 2017). Actin depolymerising drugs such as Cyto- facilitated by the acetyltransferase Mec-17 (αTAT1), which can be chalasin D or Latrunculin abolished the scission of ectosomes, which reversed during ciliary disassembly by the deacetylase HDAC6 (Kim underlines the importance of actin in this process (Nager et al., 2017; et al., 2013; Ran et al., 2015; Shida et al., 2010). Besides regulating Phua et al., 2017). ciliogenesis by acetylation of microtubules, further studies found that In accordance with this, Phua et al. were able to visualise phalloidin- Mec-17 upregulates the expression of myosin IIB which promotes cil- stained F-actin at the spot of cilia excision in murine fibroblasts (Phua iogenesis in an actin dependent manner (Rao et al., 2014). Myosin IIB et al., 2017). They suggested that the actin regulators cofilin-1, fascin organises the pericentrosomal preciliary compartment (PPC) including and the small GTPase Kras are recruited via the phospholipid PI(4,5)P2 CEP290 and PCM-1 by increasing actin dynamics. These data suggest to induce actin polymerisation at the site of primary cilia scission (Phua that Mec-17 impacts the early steps of ciliogenesis via a combined et al., 2017). approach of influencing microtubule acetylation directly and regulating The finding that polymerised F-actin at the ciliary tip is essential for actin regulators transcriptionally. ectocytosis was recapitulated in more recent studies performed in The regulation of both actin and microtubule dynamics during cil- hTERT-RPE-1 cells (Corral-serrano et al., 2020; Wang, Hu et al., 2019). iogenesis is often attributable to regulators of PCP signalling, which will Wang et al. found this process to be dependent on direct binding be- be discussed in section 5. tween F-actin and the small GTPase Rab7. Corral-Serrano et al. showed that F-actin localisation throughout the primary cilium can be triggered 3. F-actin in cilia function by overexpression of C2orf71/PCARE (photoreceptor cilium actin regulator), which recruits F-actin together with the Arp2/3 complex To what extend actin is present in the cilium is still a topic of debate. activating factor WASF3 to the cilium (Corral-serrano et al., 2020). This Due to technical limitations and high levels of cytoplasmic actin making led to actin-positive ciliary membrane expansions at the ciliary tip visualisation in the cilium challenging, only few studies have been able which likely proceeds the process of cilia decapitation or ectocytosis. to identify ciliary F-actin (summarised in Fig.1). An Arp2/3 branched F- This is in line with studies by Spencer et al. indicating C2orf71/PCARE, actin network is found at the ciliary base and the ciliary pocket acts as an WASF3 and Arp2/3 being part of ectosomes shed by mutant photore- interface between stable and dynamic actin filaments (Farina et al., ceptor cells as discussed above (Spencer et al., 2019). Another study in 2016; Molla-Herman et al., 2010; Saito et al., 2017). However, actin murine NIH-3T3 fibroblasts indicated that overexpression of the formin composition within the cilium is likely to be cell type and cell cycle FHDC1 traps F-actin inside elongated cilia upon defective cilia disas- dependent. Early on, F-actin was shown to be present in the connecting sembly (Copeland et al., 2018); however, formin activity seems to be cilium of photoreceptor cells, representing the transition zone of this dispensable for ciliary decapitation (Nager et al., 2017). highly specialised primary cilium (Chaitin et al., 1984; Williams, 1991; Taken together, these studies indicate that F-actin might be localised Woodford and Blanks, 1989). In epithelial cell culture, Lee et al. were in primary cilia of multiple cell types, but its dynamic localisation and 3 L. Brücker et al. I n t e r n a t i o n a l J o u r n a l o f B i o c h e m i s t r y a n d C e l l B i o l o g y 129 (2020) 105877 cell-type specific expression restricted its visualisation in cilia for a long interconnected signalling cascades involve key actin regulators such as time. Its function in ciliary decapitation includes several key actin reg- actin nucleators or capping proteins, but also GTPases, histone modi- ulators and there might be many more actin regulators involved in cilia fiers, transcriptional regulators as well as micro-RNAs. Their complex decapitation processes as suggested by proteomic screens. Ciliary ecto- crossover in activity impacts underlying actin dynamics and subse- cytosis might also be possible at the basal part of the ciliary membrane quently cilia stability in various mechanisms or feedback loops. One of or the ciliary base (Hogan et al., 2009; Huang et al., 2016; Pampliega the key actin regulators involved in several cilia disassembly mecha- et al., 2013), a process which might also involve actin. An evidence for nisms is the Arp2/3 complex. The Arp2/3 complex is a well- this is the direct interaction between actin and the Arf-like small GTPase characterised actin nucleator essential for organising actin filaments Arl13b (Barral et al., 2012), which is associated with the ciliopathy into branched actin networks. Arp2/3 was shown to nucleate actin fil- Joubert syndrome and is commonly used as a specific ciliary membrane aments at centrosomes and to facilitate ciliary vesicle transport to the marker (Cevik et al., 2010). It might be plausible that Arl13b also re- basal body (Farina et al., 2016). Suppression of actin polymerisation via cruits actin inside the cilium. In some of the studies discussed above, Arp2/3 inhibition results in immobilisation of IFT trains at the ciliary actin is found throughout the cilium and not just at the site of ciliary tip, promoting ciliogenesis (Cao et al., 2012; Kim et al., 2010; Yeyati abscission, thus actin might function in other processes at the transition et al., 2017). Combined, these functions of Arp2/3 suggest that it acts as zone or ciliary pocket. a negative regulator of ciliogenesis. Actin polymerisation also plays a role in HDAC6 mediated ciliary 4. Actin dynamics and the effect on ciliation disassembly, most likely via antagonism between the branched actin regulators cortractin and missing-in-metastasis (MIM) (Bershteyn et al., Besides the novel role of actin in ciliary decapitation, numerous 2010; Ran et al., 2015). The histone deacetylase HDAC6 mediates ciliary studies observed an antagonistic effect of actin polymerisation on cil- disassembly via deacetylation of cortractin, a Arp2/3 complex activator, iogenesis. Blocking actin polymerisation via inhibitors such as cyto- and alpha-tubulin (Ran et al., 2015). MIM inhibits actin filament chalasin D or latrunculin B stabilises primary cilia, preventing ciliary nucleation directly through interaction with actin and on the other disassembly (Kim et al., 2010; Pitaval et al., 2010). Concordant studies hand, promotes actin polymerisation via interaction with cortractin, showed that F-actin depolymerising proteins such as cofilin-1 or gelsolin N-WASP and the GTPase Rac1 (Bompard et al., 2005; Lin et al., 2005; increases ciliogenesis (Kim et al., 2010; Kim et al., 2015). Since F-actin Mattila et al., 2003; Yamagishi et al., 2004). It was further shown that polymerisation occurs during ciliary disassembly, it was suggested that MIM stabilises primary cilia in a complex way via regulating the inter- the presence of polymerised actin suppresses ciliogenesis potentially via action between Cdc42 and the polarity protein aPKC (Drummond et al., inducing ciliary disassembly components (Bershteyn et al., 2010; Liang 2018). The GTPase Cdc42 promotes N-WASP and Arp2/3 mediated actin et al., 2016). A graphical representation of actin regulators involved in nucleation through Toca-1 and is therefore one of the key actin regu- ciliary assembly or disassembly is given in Fig. 2. lators. It further recruits both MIM as well as the polarity complex of The polymerisation of F-actin is regulated by various regulators and aPKC/Par3/Par6 to the base of the cilium where they influence is downstream of several signalling pathways. One example is PCP sig- Hedgehog signalling and ciliogenesis in an epistatic manner (Drum- nalling which will be discussed in section 5. The often overlapping and mond et al., 2018). Cdc42 and Arp2/3 have further shown to be Fig. 2. Graphical representation of the crosstalk between actin regulatory proteins during ciliary assembly and disassembly. Several actin regulators lead to ciliary disas- sembly via polymerisation of actin filaments (red) or transcriptional activation of YAP/TAZ, which transcribe disassembly factors such as AURKA or PLK1. Upon actin depolymerisation induced by actin capping proteins, which also inhibit YAP/TAZ translocation into the nucleus, primary cilia are assembled. HDAC6: Histone deacetylase 6, KDM3A: Lysine Demethylase 3A, MLL2: Mixed-lineage Leukemia Protein 2, Arp2/3: Actin Related Protein2/3, N-Wasp: Neural Wiskott-Aldrich Syndrome Protein, Cdc42: Cell Division Cycle 42, aPKC: Atypical Protein Kinase C, YAP: Yes-associated Protein, TAZ: Transcriptional Coactivator with PDZ- binding Motif, PLK1: Polo Like Kinase 1, AURKA: Aurora Kinase A, MIM: Missing-in- Metastasis, LIMK2: Lim Domain Kinase 2, TESK1: Testis Associated Actin Remodelling Kinase 1, CapZ: Capping Actin Protein Of Mus- cle Z-Line, TOCA-1: Transducer Of Cdc42- Dependent Actin Assembly Protein 1, ABLIM: Actin Binding LIM Protein. 4 L. Brücker et al. I n t e r n a t i o n a l J o u r n a l o f B i o c h e m i s t r y a n d C e l l B i o l o g y 129 (2020) 105877 influenced by Tctex-1, a component of the cytoplasmic dynein 1 com- R-Ras and its interactor and actin-binding protein Filamin-A in multi- plex (Saito et al., 2017). Dynein independently, Tctex-1 was shown to ciliated cells (Chevalier et al., 2015; Mercey et al., 2016). Since the accelerate clathrin-mediated endocytosis at the ciliary pocket through apical actin network is required for basal body anchoring, which in- interaction and activation of Arp2/3 and Cdc42 and is therefore crucial volves both the actin organising protein R-Ras and Filamin-A, this during early steps of ciliary disassembly. impaired multiciliogenesis. Besides HDAC6, recent data indicated two other histone modifiers to In recent years, the role of many actin regulators was investigated in be involved in negative regulation of ciliogenesis. KDM3A, a multi- the context of ciliogenesis. It seems that most actin polymerisation functional protein histone lysine demethylase, was shown to recapitu- factors have a negative role in ciliogenesis potentially via inducing late the inhibiting effect of Arp2/3 on ciliogenesis (Yeyati et al., 2017). ciliary disassembly factors in complex signalling cascades. On the other Kdm3a− /− mice mirror phenotypes associated with human ciliopathies hand, actin depolymerisation increases ciliogenesis, which shows that and KDM3A− /− cells exhibit longer and instable cilia. KDM3A directly the regulation of actin dynamics has an important effect on ciliogenesis. binds to actin and transcriptionally activates its expression (Yeyati et al., However, the cilium itself was shown to regulate several signalling 2017). Since increased actin polymerisation reverses the KDM3A pathways which affect downstream actin networks and subsequently phenotype, the authors attribute the cilia phenotype on loss of actin ciliogenesis. In the following paragraph we will try to shed light on these dynamics at the ciliary base. The histone lysine methylase, complex feedbacks loops while focussing on PCP signalling. mixed-lineage leukemia protein 2 (MLL2) also seems to play a negative role on ciliogenesis via affecting actin proteins. Depletion of MLL2 in 5. Ciliary signalling affecting downstream actin networks RPE1 cells increased both ciliary length and number (Yang et al., 2019), and patients with mutations in MLL2 resemble the phenotype of ciliary Several actin regulators were shown to impact ciliogenesis in a dysfunction-associated coronary heart disease (Ang et al., 2016; Digilio negative way as described above. On the other hand, many signalling et al., 2017). It was shown that MLL2 facilitates gene expression of the pathways directed by the primary cilium affect downstream actin net- actin-associated proteins formin1, the CDC42 effector protein works, potentially via interconnections with other networks and sub- CDC42EP3, myosin 5b, synaptopodin and cofilin2 which subsequently sequently influencing ciliogenesis via feedback loops. Some examples affect ciliogenesis via Arp2/3 mediated branched actin regulation. for signalling pathways targeting the actin cytoskeleton are AKT/mTOR, The transcriptional coactivators YAP/TAZ (Yes-associated protein/ Notch and Hippo signalling (Cao et al., 2017; Seo and Kim, 2018; Wu transcriptional coactivator with PDZ-binding motif) also influence cil- et al., 2016). One of the ciliary signalling pathways directly acting on the iogenesis via regulation of actin polymerisation. Under actin assembly actin cytoskeleton is the non-canonical WNT signalling pathway. It is conditions, YAP/TAZ translocates into the nucleus and upregulates also referred to as the planar cell polarity (PCP) pathway since its acti- ciliary disassembly factors such as Aurora Kinase A (AURKA) and Polo vation results in coordinated orientation of cells within a tissue (Gong Like Kinase 1 (PLK1), thereby inhibiting ciliogenesis (Das et al., 2016; et al., 2004; Luo et al., 2020). In contrast to canonical WNT signalling, Kim et al., 2015). Upon actin disassembly, YAP/TAZ is restrained in the which is coupled with decreased ciliation, PCP signalling is often cytoplasm and inactivated via F-actin capping proteins such as cofilin, accompanied by induced ciliogenesis (Gerdes et al., 2007; Lienkamp CapZ and gelsolin, inducing ciliogenesis (Aragona et al., 2013; Kim et al., 2012; McMurray et al., 2013). et al., 2015). Notably, these downstream F-actin capping proteins were Similar to the canonical/β-catenin dependent signalling cascade, shown to be inactivated via Lim Domain Kinase 2 (LIMK2) and Testis initiation of the PCP pathway requires activation of the Frizzled cor- Associated Actin Remodelling Kinase 1 (TESK1), which represent key eceptor complex via binding of a WNT ligand (Minegishi et al., 2017; Wu players in actin remodelling. LIMK2 and TESK1 promote YAP/TAZ ac- et al., 2013). This requires a stable microtubule network upon which tivity, subsequently inducing ciliary disassembly (Kim et al., 2015). An Frizzled receptors are trafficked to the membrane to maintain the PCP opposing upstream effector of cofilin is the nuclear distribution gene C phenotype (Mathewson et al., 2019). The binding of WNT ligands to (NudC), which in contrast to LIMK2/TESK1 stabilises cofilin1, and Frizzled receptors results in Inversin-mediated recruitment of Dishev- therefore inhibits ciliogenesis (Zhang et al., 2016). elled to the plasma membrane (Simons et al., 2005). Dishevelled further To make matters more complex, a further study showed that jas- binds to the formin Daam1 and the small GTPase Rac1 which activate plakinolide (Jasp), a potent inducer of actin assembly, actually induced downstream signalling cascades via actin regulators RhoA, Rock and ciliogenesis (Nagai and Mizuno, 2017). This effect is opposite to the Jnk, resulting in rearrangements of the subapical actin network (Habas studies discussed above which suggest actin polymerisation being et al., 2001; Liu et al., 2008). Dishevelled is also regulated via the core antagonistic to ciliogenesis. Jasplakinolide however, was shown to PCP protein Vangl2 in both negative and positive ways. Wnt5a activated suppress the inhibiting effect of YAP on ciliogenesis (Nagai and Mizuno, Vangl2 supports Inversin-mediated recruitment of Dishevelled to the 2017). This is a good example of how complex and interconnected actin plasma membrane but also inhibits the binding of Dishevelled to Daam1 regulatory drugs affect ciliation. (Seo et al., 2017; Yang et al., 2017). Vangl2 is one of the core PCP Further studies indicated that the effect of actin modulators on cilia proteins since it interacts with and recruits PCP regulators such as disassembly might be facilitated through micro-RNAs. Micro-RNA Prickle, affecting downstream RhoA signalling (Nagaoka et al., 2019). regulation of ciliogenesis has already been discussed in Walentek et al., Besides influencing the actin network via downstream cascades, both however, the regulation via actin proteins has not been described WNT proteins and Frizzled receptors were shown to localise directly to (Walentek et al., 2014). actin dependent cell protrusions such as filopodia and cytonemes, The conserved microRNA miR-129-3p was shown to promote both influencing their formation (Mattes et al., 2018; Sagar et al., 2015; ciliogenesis and ciliary elongation by suppressing the expression of Stanganello et al., 2015). ARP2, the Cdc42 effector TOCA-1, and F-actin binding proteins Inversin was one of the first proteins to highlight the association ABLIM1/3 and CP110 that are all required for branched actin network between cilia and PCP signalling. As stated above, upon PCP signalling, formation (Cao et al., 2012). The centriolar coiled coil protein of 110 Inversin recruits Dishevelled to the plasma membrane where it activates kilodalton (CP110) represents a potent cilia inhibitor since its removal downstream signalling pathways (Simons et al., 2005). Inversin was from the mother centriole is necessary for its maturation into a basal further found to localise to primary cilia and mutations in the NPHP2 body (Reviewed in Tsang and Dynlacht, 2013). In multiciliated cells gene, encoding Inversin, can lead to the ciliopathy nephronophthisis (MCC), CP110 was also shown to be under control of the microRNA type 2 (Otto et al., 2003; Shiba et al., 2009). Inversin binds to micro- family miR-34/449 upon coactivation by MCC ciliary transcription fac- tubules in vitro (Nürnberger et al., 2004) and also impacts the cortical tors rfx2, foxj1 and myb (Song et al., 2014; Walentek et al., 2016). The actin network independently of the cell cycle stage (Werner et al., 2013). same microRNAs miR-34/449 were found to impact the small GTPase Mitotic cell rounding, which is dependent on a functional cortical actin 5 L. Brücker et al. I n t e r n a t i o n a l J o u r n a l o f B i o c h e m i s t r y a n d C e l l B i o l o g y 129 (2020) 105877 network, is defective in Inversin knockout cells, accompanied by RhoA levels, which consequently affected ciliogenesis again (Hernan- increased filopodia numbers (Werner et al., 2013). It was suggested that dez-Hernandez et al., 2013; May-Simera et al., 2015). the Inversin-dependent actin phenotype might be due to its regulation of Since PCP affects the polarity of cells via modulation of actin dy- Dishevelled, since it was shown that Dishevelled regulates actin via namics, it is required for the orientation of basal bodies and primary cilia RhoA and Daam1 (Kim and Davidson, 2011; Liu et al., 2008). Tran- within epithelial tissues (Boutin et al., 2014; Carvajal-Gonzalez et al., scriptome analysis further revealed dramatic changes in regulators of 2016; Fuertes-Alvarez et al., 2018; Namba and Ishihara, 2020). This is WNT signalling, focal adhesions and actin dynamics in Inversin especially important for the orientation of motile cilia in respiratory knockout cells and mislocalisation of key actin regulators RhoA, Rac1 epithelia as well as in sensory hair cells in the developing cochlea, de- and Cdc42 accompanied by a PCP phenotype (Veland et al., 2013). fects of which often accompany the ciliopathy phenotype (May-Simera, Overall, Inversin seems to be a key player in the processes connecting 2016; Tsuji et al., 2018; Vladar et al., 2015). The mammalian cochlea cilia, WNT/PCP signalling and cytoskeletal dynamics. represents a good model to study PCP signalling since the elongation and A proteomic screen identified the formin Daam1, an actin nucleator rotation of actin-based hair bundles is highly dependent on correct and interactor of Dishevelled, as a potential component of primary cilia localisation of the primary cilium, namely the kinocilium. The actin (Ishikawa et al., 2012). Daam1 has been shown to form a complex with nucleator Cobl (Cordon-Bleu) is crucial for PCM dependent basal body the ciliary transition zone protein Nphp4 via the PCP component Intu positioning of the kinocilium in the cochlea via affecting actin poly- which regulates the subapical actin network (Yasunaga et al., 2015). merisation through PCP maintenance (Haag et al., 2018). The Rho Interestingly, Daam1 was further found to localise to ciliary vesicles and GTPase Cdc42 is another PCP regulator which affects kinocilium posi- its formin/actin binding activity was shown to be required for cilio- tioning through interaction with the polarity protein aPKC (Kirjavainen genesis in vertebrate kidney cells, although it is not necessary for cili- et al., 2015). One of the key PCP proteins required for basal body ation in X. laevis embryos (Corkins et al., 2019). positioning is Vangl2. Interactions between Myosin 1d and Vangl2 Another protein linking cilia, PCP and actin is the PCP mediator regulate basal body alignment which emphasises an involvement of the Wdpcp, also known as BBS15. Mutations in the Wdpcp have been found actomyosin cytoskeleton in both PCP and ciliogenesis (Juan et al., 2018; to cause Bardet-Biedl syndrome, featuring cardiac outflow tract and Tingler et al., 2018). Vangl2 further recruits Prickle to affect cilia length cochlea defects. Similar to Inversin, Wdpcp localises to the transition and basal body positioning (Chu et al., 2016). Another study suggested zone of cilia where it recruits essential ciliary proteins and is further basal body positioning being dependent on the interaction between found to regulate actin filaments and focal adhesions (Cui et al., 2013; vangl2 and arl13b, a key component of the primary cilia membrane and Kim, Shindo et al., 2010). As one of the key planar cell polarity effector thus affecting PCP signalling in zebrafish (Song et al., 2016). (PPE) proteins, Wdpcp regulates PCP signalling in multiple ways by An interplay between PCP signalling and ciliogenesis could also be interaction with Dishevelled and maintaining a stable cortical actin shown on the transcriptional level. The transcription factor Foxj1a is cytoskeleton (Park et al., 2015; Wang et al., 2017). required for ciliogenesis in different tissues (Chen et al., 1998; Stubbs Highly conserved proteins that regulate PCP and play a role in cil- et al., 2008). Activity of Foxj1a was already shown to be temporally iogenesis, have recently been termed CPLANE proteins (ciliogenesis and influenced by the canonical WNT/β-catenin signalling co-transcription planar polarity effectors) (Toriyama et al., 2016). This module contains factors Lef1 and Tcf7 (Caron et al., 2012; Zhu, Xu et al., 2015). On the the classical planar cell polarity effector (PPE) proteins Intu, Fuz and other hand, Foxj1a was also shown to be under transcriptional control of Wdpcp as well as ciliopathy proteins such as Rsg1 and Jbts17 (C5orf42). the transcription factor TAp73 (p73) (Marshall et al., 2016; Nemajerova Further expanding this protein network, the CPLANE interactome con- et al., 2016), which is required for PCP signalling and actin dynamics via sists of IFT-A components, dynein transport proteins and CCT chaper- transcriptional modulation of non-muscle Myosin II activity (Fuerte- onins. Interestingly, Jbts17 was found to recruit CPLANE to the basal s-Alvarez et al., 2018). Hence, Foxj1a seems to be a key regulator of body where it further recruits IFT components. More recent studies ciliogenesis, which is affected in multiple ways by both β-catenin identified that CPLANE proteins Intu and Fuz are functionally related to dependent WNT and PCP signalling. Rab GDP-GTP exchange factors (GEFs), and contribute towards the As seen in this chapter, PCP signalling is regulated by cilia proteins initial steps of ciliary vesicle docking (Gerondopoulos et al., 2019). thus affecting actin networks to maintain cell polarity. In Fig. 3, a Consistent with both studies, knockout of the small GTPase Rsg1, graphical representation shows the regulation of ciliary signalling on the component of CPLANE, was shown to decrease ciliation and result in actin network via key components. However, it is still not clear whether ciliopathy associated phenotypes including polydactyly (Agbu et al., disturbance of ciliogenesis results in PCP defects and consequently actin 2018). For a more detailed review on CPLANE proteins and their func- defects, or if ciliary proteins regulate subsequent actin networks inde- tion in ciliogenesis see Adler and Wallingford (2017). pendently of their ciliary role. As described in section 4, actin dynamics The intraflagellar transport (IFT) machinery of the primary cilium is regulate ciliogenesis, highlighting the complex feedback loops behind particularly regulated by the BBSome complex (Blacque et al., 2004). these regulatory mechanisms. The crosstalk between many different Recent data indicate an involvement of both IFT and BBS proteins in effectors and downstream PCP signalling targets highlights the multi- maintenance of PCP signalling via trafficking of key PCP regulators. factorial regulation between actin dynamics and ciliogenesis. Several Bbs and Ift proteins have been shown to interact with the core PCP protein Vangl2, and knockout of those proteins results in PCP de- 6. Role of actin in ciliopathies fects in mouse tissues, presumably due to defective Vangl2 trafficking (Jones et al., 2008; May-Simera et al., 2015; McMurray et al., 2013; Ross Defects in cilia function can result in a range of genetic disorders et al., 2005). In accordance with this, loss of the IFT38 protein Cluap1 termed ciliopathies. Ciliopathies comprise syndromic diseases such as leads to enhanced actin stress fibre formation, accompanied by a Bardet-Biedl syndrome, Meckel-Gruber syndrome, Alström syndrome or migration phenotype (Beyer et al., 2018). Additionally, BBS proteins McKusick–Kaufman syndrome, as well as non-syndromic ciliopathies were shown to interact with the PCP protein Inversin and maintain its including retinitis pigmentosa or polycystic kidney disease. Primary trafficking to the basal body in ciliated cells (May-Simera et al., 2018, phenotypes are characterised by retinal degeneration, hearing loss, 2015; Patnaik et al., 2019). Besides their association with PCP signalling obesity, polydactyly and renal defects, with many secondary features via Vangl2, several Bbs proteins have further been shown to localise to occurring including mental retardation or infertility (Goetz and Ander- actin-rich structures such as filopodia or lamellipodia in murine kidney son, 2010; Waters and Beales, 2011). In Fig. 4, some examples of cells, indicating alternative cilia-independent functions for these pro- affected tissues are shown with the specific primary cilia depicted. Since teins (Hernandez-Hernandez et al., 2013; Patnaik et al., 2020). They actin plays a prominent role in ciliation, many ciliopathy phenotypes are were further shown to affect these structures via downregulation of likely attributed to actin-associated mechanisms. In the following 6 L. Brücker et al. I n t e r n a t i o n a l J o u r n a l o f B i o c h e m i s t r y a n d C e l l B i o l o g y 129 (2020) 105877 degeneration (May-Simera et al., 2017). This is driven by the fact that in addition to being the most common phenotype in syndromic cil- iopathies, non-syndromic retinitis pigmentosa genes often encode ciliary proteins and are responsible for roughly 25 % of vision loss in adults (Bujakowska et al., 2017; May-Simera et al., 2017). Mammalian photoreceptor cells are made up of the inner and the outer segment, connected via the so-called connecting cilium (CC). Both the connecting cilium as well as the outer segment represent parts of a highly special- ized primary cilium, with the connecting cilium corresponding to the transition zone and the outer segment representing the enlarged ciliary axoneme (Roepman and Wolfrum, 2007, see Fig. 4a). Photoreceptors are required to be highly metabolically active to maintain the constant turnover of membranous discs containing rhodopsin from the inner to the outer segment across the connecting cilium. In the outer segment, these discs are shed and phagocytosed by the retinal pigment epithelium (RPE) (Mazzoni et al., 2014). There are many associations between photoreceptor formation and actin dynamics (also reviewed in Megaw and Hurd, 2018). Early studies showed actin localising to the distal end of the connecting cilia of outer segments and suggested that it might be involved in photoreceptor disc formation during evagination of the plasma membrane at this location (Chaitin et al., 1984; Williams et al., Fig. 3. Ciliary PCP signalling regulates downstream actin dynamics. Cilia 1988). More recently it was shown that the transport of rhodopsin to the IFT and BBS proteins interact with PCP proteins Vangl2, Dishevelled and photoreceptor outer segment is mediated by the small GTPase Rab8 in Inversin. PCP proteins and polarity proteins such as the CPLANE complex an actin-dependent manner (Deretic et al., 2004). Furthermore, prote- activate downstream actin regulators such as Cdc42, RhoA, Daam1, subse- omic approaches identified the actin nucleators Arp2/3 as key players in quently affecting actin rearrangements and cell polarity. PCP: Planar Cell po- photoreceptor disc formation initiation (Spencer et al., 2019). Studies larity, IFT: Intraflagellar transport, BBS: Bardet-Biedl syndrome, Vangl2: Van have shown that loss of numerous actin proteins contributes to photo- Gogh-Like 2, CPLANE: Ciliogenesis and Planar Polarity Effectors, Cdc42: Cell receptor degeneration in thus far unclassified diseases (Dollar et al., Division Cycle 42, aPKC: Atypical Protein Kinase C, RhoA: Ras Homolog Family 2016; Fontainhas and Townes-Anderson, 2011; Moshiri et al., 2017; Member A, Daam1: Dishevelled Associated Activator Of Morphogenesis 1. Ríos et al., 2020; Wang et al., 2019; Wang, Hu et al., 2019; Wang and Townes-Anderson, 2015). section, we highlight the role of actin dynamics in ciliary diseases. These Other aspects of ciliogenesis have also been shown to lead to actin- newly identified actin-related pathways offer potential entry points into related retinal degeneration. The protein EYS (Eyes shut homolog) is developing therapeutic approaches. important for development of photoreceptor cells and mutations of its gene can lead to autosomal recessive retinitis pigmentosa and cone-rod 6.1. Actin function in cilia of the visual system dystrophy (Abd El-Aziz et al., 2008). Knockout studies in zebrafish revealed disrupted F-actin filaments in photoreceptors and defective Arguably the most common ciliopathy phenotype is retinal targeting of outer segment proteins, indicating a role for EYS in F-actin Fig. 4. Primary cilia in tissues affected in ciliopathies. A Primary cilia are essential for visual function in the retina. Both the connecting cilium and the outer segment of the light sensitive photoreceptor neuron represent a highly specialized primary cilium (red). The outer segment attaches to the retinal pigment epithelium (RPE), a pigmented monolayer epithelium with numerous actin-based apical processes, which engulfs shed outer segment discs and is therefore critical for proper photoreceptor function. The RPE is also ciliated and cilia defects affect RPE development and function. B In the inner ear, the cochlea epithelium contains hair cells exhibiting actin-based stereocilia, the orientation of which is dependent on a specialized primary cilium, the kinocilium (red). Kinocilia defects result in misaligned stereocilia bundles and are associated with auditory symptoms in patients. C The human kidney consists of epithelial cells lining the nephric tubules. Primary cilia are found on the apical side of epithelial cells throughout the renal tubules. Defects in cilia development in the kidney are associated with the ciliopathy polycystic kidney disease (PKD). D Hypothalamic neurons also exhibit primary cilia. Ciliary defects in these neurons are thought to be associated with resistance to the satiety hormone leptin, underlying obesity in ciliopathies. 7 L. Brücker et al. I n t e r n a t i o n a l J o u r n a l o f B i o c h e m i s t r y a n d C e l l B i o l o g y 129 (2020) 105877 morphology and actin-dependent protein transport into the outer (Jagger and Forge, 2012; Jones et al., 2008; Montcouquiol et al., 2003; segment (Lu et al., 2017). Further it was shown that the gene retinitis Ross et al., 2005). Kinocilium positioning and disassembly is critical pigmentosa 2 (RP2), mutations of which lead to retinal degeneration, dependent on an intact actin network and PCP signalling, again high- regulates the osteoclast-stimulating factor 1 (OSTF1) as well as Myosin lighting the complex interplay between cilia and PCP (Haag et al., 2018; Ie (Myo1e), thereby influencing cell motility in an actin-dependent Kirjavainen et al., 2015). manner (Lyraki et al., 2018). Mutations in the Retinitis Pigmentosa Although the auditory phenotype in most ciliopathies is subclinical, GTPase regulator (RPGR) leads to X-linked retinitis pigmentosa it is highly prominent in Alström syndrome. The basal body protein (Gakovic et al., 2011; Megaw et al., 2017). RPGR has been shown to ALMS1 is not only involved stereocilia organisation (Jagger et al., directly regulate actin disassembly in the photoreceptor connecting cilia 2011), but similar to other ciliopathy proteins it also interacts with the via the actin modulator gelsolin, thus causing rhodopsin mislocalisation actin cross-linker α-actinin 4 (Collin et al., 2012). In line with this, and blindness in mice (Megaw et al., 2017). In Rpgr knockout mouse ALMS1 fibroblasts show abnormalities in actin stress fibre morphology retinae, actin polymerisation is increased due to upregulation of RhoA (Collin et al., 2012). and its effector RTKN2 (Rhotekin2), contributing to disrupted ciliary trafficking of M-opsin (Rao et al., 2016). Recent studies attributed this to 6.3. Actin in kidney disease development mutations in Roundabout Guidance Receptor 1 (ROBO1), a known RhoA/actin regulator in axon guidance, which might be regulated by One of the most critical clinical features affecting ciliopathy patients RPGR (Appelbaum et al., 2020). Concordant with this, Patnaik et al. is kidney disease (Devlin and Sayer, 2019). So far, several studies have showed upregulated RhoA activity in the absence of Rpgr which was shown that actin disorganisations contributes to ciliopathy-related kid- accompanied by increased levels of Dishevelled due to impaired pro- ney diseases. Fig. 4C depicts a nephric tubule with the primary cilia teasomal degradation (Patnaik et al., 2018). Since Dishevelled mediates oriented to the apical side. A recent proteomic study revealed down- PCP signalling subsequently inducing ciliogenesis and actin dynamics, regulations of actin-related proteins in urinary extracellular vesicles of these findings highlight the complex regulation of Rpgr on ciliogenesis ciliopathy patients exhibiting kidney phenotypes (Stokman et al., 2019). via PCP signalling and proteasomal activity. Among inherited cystic kidney disorders, autosomal dominant pol- Mutations in C2orf71/PCARE (photoreceptor cilium actin regulator) cystic kidney disease (ADPKD) is the most common form, and it is lead to inherited retinitis pigmentosa (RP54) characterised by progres- caused by mutations in polycystic kidney disease (PKD) 1 or 2 (Torres sive rod photoreceptor loss (Collin et al., 2010; Kevany et al., 2015; and Harris, 2009). Polycystin-1 and 2 (PC1/2), the proteins encoded by Nishimura et al., 2010). C2orf71/PCARE has recently been shown to the PDK genes, form a G-protein coupled receptor complexed with a recruit F-actin to both the basal body and connecting cilia of photore- calcium permeable channel. Both PC proteins were shown to localise to ceptor cells by interacting with the Arp2/3 complex activator WASF3, primary cilia in the kidney (Pazour et al., 2002; Yoder et al., 2002) and making it an important regulator of actin-based outer segment disc they are involved in the calcium signalling branch of WNT signalling formation (Corral-serrano et al., 2020). PCARE and several other actin (Kim et al., 2016). However similar to other PCP proteins, PC1 was regulators such as Wasf3, cofilin1 and RhoA were further identified in further shown to localise to other cellular regions and to affect actin ectosomes shed from murine photoreceptors exhibiting defective disc dynamics. In particularly, PC1 is found at lamellipodia of migrating formation (Spencer et al., 2019). kidney epithelia cells where it forms a protein complex with the key Photoreceptors are not the only ciliated cell type in visual system. actin regulator N-Wasp and Pacsin-2 (Yao et al., 2014). Moreover, PC1 is Another critical cell type is the retinal pigment epithelium (RPE) which required for proper binding of N-Wasp to Arp3, thus consequently is required for numerous critical processes in the visual cycle. Actin rich affecting actin nucleation and lamellipodia formation. In a more recent apical processes that extend from the RPE apical membrane engulf approach, miRNA profiles of PKD mouse models revealed an upregula- photoreceptor outer segments (Fig. 4a), and this interaction is required tion for miRNA-182-5p, which targets key actin target genes such as for correct phagocytosis of shed outer segments. Correct cilia function is Wasf2, Dock1, and Itga4 (Woo et al., 2017). This resulted in inhibited vital for development and maturation of the RPE, with ciliary defects actin cytoskeleton formation and increased cyst formation. Finally, PC1 resulting in immature apical processes which are unable to phagocytose was recently shown to regulate RhoA and ROCK signalling via interac- correctly (Kretschmer et al., 2019; May-Simera et al., 2018; Patnaik tion with the specific RhoGAP ARHGAP35, subsequently affecting cilia et al., 2019). Further studies have shown that F-actin morphology seems length (Streets et al., 2020). to affect phagocytic function through regulation by Rho family GTPases Besides PC1, several studies focused on its complex partner PC2, a such as Rac1 (Bulloj et al., 2018; Müller et al., 2018), which might also calcium2+ permeable ion channel. PC2 was also shown to localise to be happening in a cilia-dependent manner. A further effector of lamellipodia and possibly associates with the actin cytoskeleton via actin-dependent phagocytosis is the actin motor protein Myosin VI. cortractin (Gallagher et al., 2000). PC2 directly interacts with the actin Myosin VI enables a rapid, more randomly targeted trafficking of bundling protein alpha-actinin in several kidney cell lines and its cal- phagosomes to the RPE (Hewage and Altman, 2018). This regulation cium channel activity was shown to be influenced by several requires outer segment binding, engulfment and subsequent F-actin as- actin-binding proteins like alpha-actinin, filamin, profilin and gelsolin sembly and rearrangement beneath bound particles, and seems to (Cantero and Cantiello, 2015; Li et al., 2005; Wang et al., 2015). It was incorporate Myosin II as well as Myosin VI, most likely regulated further shown to interact with the RhoA GTPase binding formin mDia1 downstream of PI3 kinases (PI3K) and AKT signalling (Bulloj et al., and to act directly on actin via filamin-A in a calcium-dependent way 2013). Finally, two recent transcriptomic studies suggested the activity (Rundle et al., 2004; Wang et al., 2015). of the RPE being tightly regulated by actin remodelling of tight junctions A third ciliopathy protein highlighting the connection between actin in a circadian manner (DeVera and Tosini, 2020; Louer et al., 2020). and cilia is the inositol polyphosphate 5-phosphatase OCRL1, mutations in which cause the kidney phenotype in Lowe syndrome. The OCRL1 6.2. Defects of the auditory system protein localises to primary cilia in kidney cells and affects ciliary length when mutated (Coon et al., 2012; Luo et al., 2012; Rbaibi et al., 2012). Besides ocular phenotypes, many ciliopathies are associated with Even before Lowe syndrome was diagnosed as a ciliopathy, OCRL1 auditory symptoms. One reason for this is that cochlea hair cells in the deficiency was shown to affect actin architectures and regulators like inner ear display mechanosensing actin-based stereocilia, whose char- gelsolin and alpha-actinin (Suchy and Nussbaum, 2002). OCRL1 main- acteristic patterning is dependent on a true microtubule-based kinoci- tains RhoA-Cofilin signalling via activation of Rac1 during membrane lium (Fig. 4b). Virtually all ciliopathy mouse models display misoriented remodelling (Coon et al., 2009; Madhivanan et al., 2012; Vicinanza or rotated stereociliary bundles, a readout for defective PCP signalling et al., 2011; Zhu et al., 2015). 8 L. Brücker et al. I n t e r n a t i o n a l J o u r n a l o f B i o c h e m i s t r y a n d C e l l B i o l o g y 129 (2020) 105877 6.4. Actin regulation of obesity many studies correlate the progression of cancer with defects or en- hancements of ciliation, suggesting a critical balance between ciliation Another hallmark ciliopathy phenotype is obesity possibly caused by and cancer. Just as actin plays a role in both ciliogenesis and cancer, defective cilia on hypothalamic neurons (Davenport et al., 2007). This newer research combines both approaches and shows that perturbed phenotype is accompanied by a deficiency or resistance to the physio- ciliary signalling might contribute to the development of certain can- logical satiety hormone leptin (Han et al., 2014). Treatment with leptin cers. However, as discussed before, it is still not clear if defects in cil- resembles actin depolymerisation through cytochalasin D and increases iogenesis affect downstream actin networks subsequently enhancing ciliary length in hypothalamic neuronal cells (Kang et al., 2015). Leptin tumour growth, or if a remodelling of actin dynamics results in defective inhibits PTEN/GSK3β signalling which results in upregulation of ciliogenesis which in turn affects cancer progression. anterograde IFT protein mRNA. Since PTEN directly regulates the actin depolymerising factor cofilin-1 and GSK3β controls actin dynamics via 8. Conclusions Rac and Rho GTPases (Serezani et al., 2012; Sun et al., 2009), leptin seems to regulate ciliogenesis both via transcriptional activation of cilia Ciliopathy patients exhibit several clinical features such as retinal genes and upstream regulation of actin rearrangements (Kang et al., degeneration, cochlea and renal defects and obesity. Besides these 2015). Thus, Kang et al. suggested that F-actin depolymerisation is an common phenotypes, other symptoms include mental deficits or brain important downstream signalling pathway involved in leptin regulation disorders, polydactyly or liver and heart defects. Although ciliopathies of ciliary assembly. Knockout of the ciliopathy protein Lztfl1, also do not have a higher incidence for cancer development, many studies known as BBS17, leads to leptin resistance and cilia deficiency in mice also see correlations between the level of ciliation and tumour pro- (Seo et al., 2009; Wei et al., 2018). Interestingly, Lztfl1 was found to gression. Several studies indicate defective actin dynamics as underlying directly interact with actin and actin-binding proteins, thus the authors cause for defects in ciliogenesis. The emerging field highlighting the suggested that Lztfl1 is involved in downstream leptin signalling via interaction between cilia and actin regulators might help to clarify the actin dynamics (Wei et al., 2018). molecular mechanisms underlying several ciliopathies. However, it is still not clear why so many cilia proteins localise to and regulate actin 7. Actin and cilia in cancer networks. Is this regulation independent of their ciliary function or do they exert the same function at different locations? This review depicted The role of actin in cancer progression has been known for a while different regulatory pathways such as actin dynamics regulating cilio- since remodelling of the actin cytoskeleton is indispensable for cancer genesis, however ciliogenesis itself impacts actin networks via down- invasion and metastasis (Yamazaki et al., 2005). In recent years, re- stream signalling pathways. Since these complex feedback loops are searchers started seeing both a positive and negative impact of primary often cell type specific, it is vital to uncover the precise molecular cilia on cancer progression highlighting this complex relationship mechanisms underlying ciliogenesis and actin dynamics to identify (Sarkisian and Semple-Rowland, 2019). For example, in anaplastic possible starting points for therapeutic approaches in the future. ependymomas as well as choroid plexus carcinomas, ciliogenesis is decreased due to downregulation of the transcription factor FOXJ1 Declaration of Competing Interest (Abedalthagafi et al., 2016). In medulloblastoma or glioblastoma, pri- mary cilia were found to both initiate and inhibit tumour formation, in None. close relation to their regulation of Hedgehog signalling (Han et al., 2009; Hoang-Minh et al., 2016; Wong et al., 2009). More recently, the Funding role of actin in cancer-related ciliogenesis came into focus, bringing both fields together. Interestingly, cilia in glioblastoma performed exocytosis This work was funded by the Johannes Gutenberg-University Mainz, at the ciliary tip coinciding with F-actin staining at that location the Deutsche Forschungsgemeinschaft (DFG) SPP 2127 and the Hanns (Hoang-Minh et al., 2018). This suggests an involvement of actin in the Seidel foundation. process of ciliary shedding similar to the processes already described in non-cancerous cell lines (Nager et al., 2017; Phua et al., 2017; Wang, Hu References et al., 2019). One protein known to link ciliogenesis and cancer is the Clusterin Abd El-Aziz, M.M., Barragan, I., O’Driscoll, C.A., Goodstadt, L., Prigmore, E., Borrego, S., Mena, M., Pieras, J.I., El-Ashry, M.F., Safieh, L.A., Shah, A., Cheetham, M.E., Associated Protein 1 (Cluap1/IFT38). Cluap1 is an integral component Carter, N.P., Chakarova, C., Ponting, C.P., Bhattacharya, S.S., Antinolo, G., 2008. of the IFT complex of the primary cilium and is highly upregulated in EYS, encoding an ortholog of Drosophila spacemaker, is mutated in autosomal colon cancer (Takahashi et al., 2004). More recently, it was shown that recessive retinitis pigmentosa. Nat. Genet. 40, 1285–1287. https://doi.org/10.1038/ loss of Cluap1 also leads to enhanced actin stress fibre formation ng.241. Abedalthagafi, M.S., Wu, M.P., Merrill, P.H., Du, Z., Woo, T., Sheu, S.H., Hurwitz, S., accompanied by a migration phenotype (Beyer et al., 2018). The small Ligon, K.L., Santagata, S., 2016. Decreased FOXJ1 expression and its ciliogenesis peptide Thymosin β-4 sequesters G-actin and enhances actin remodel- programme in aggressive ependymoma and choroid plexus tumours. J. Pathol. 238, ling (Kim and Jung, 2016), subsequently increasing metastatic proper- 584–597. https://doi.org/10.1002/path.4682. Adler, P.N., Wallingford, J.B., 2017. From planar cell polarity to ciliogenesis and back: ties of several cancer cell lines (Cha et al., 2003; Kobayashi et al., 2002; the curious tale of the PPE and CPLANE proteins. Trends Cell Biol. 27, 379–390. Lee et al., 2015). In human cervical cancer cells, Thymosin β-4 was https://doi.org/10.1016/j.tcb.2016.12.001. found to interact with the cilia protein NPHP3, stabilising ciliogenesis Agbu, S.O., Liang, Y., Liu, A., Anderson, K.V., 2018. The small GTPase RSG1 controls a final step in primary cilia initiation. J. Cell Biol. 217, 413–427. https://doi.org/ (Lee et al., 2019). In that context, Lee et al. suggested that Thymosin β-4 10.1083/jcb.201604048. acted on ciliogenesis via regulation of actin stress fibres. In another Ang, S.Y., Uebersohn, A., Ian Spencer, C., Huang, Y., Lee, J.E., Ge, K., Bruneau, B.G., study, the known tumour suppressor and actin binding protein EPLIN 2016. KMT2D regulates specific programs in heart development via histone H3 lysine 4 di-methylation. Development 143, 810–821. https://doi.org/10.1242/ (Epithelial Protein Lost In Neoplasm) was found to be a negative regu- dev.132688. lator of ciliogenesis and cilia length via stabilisation of actin and Antonellis, P.J., Pollock, L.M., Chou, S.W., Hassan, A., Geng, R., Chen, X., Fuchs, E., translocation of Myosin Va (Gonçalves et al., 2020). Another tumour Alagramam, K.N., Auer, M., McDermott, B.M., 2014. ACF7 is a hair-bundle antecedent, positioned to integrate cuticular plate actin and somatic tubulin. suppressor, the tumour protein Tp73, regulates PCP signalling via J. Neurosci. 34, 305–312. https://doi.org/10.1523/JNEUROSCI.1880-13.2014. remodelling of the actin cytoskeleton and therefore affects the unidi- Antoniades, I., Stylianou, P., Skourides, P.A., 2014. Making the connection: ciliary rectional orientation of motile cilia in multiciliated tissues (Fuerte- adhesion complexes anchor basal bodies to the actin cytoskeleton. Dev. Cell 28, s-Alvarez et al., 2018). 70–80. https://doi.org/10.1016/j.devcel.2013.12.003. Although ciliopathies do not have a higher incidence for cancer, 9 L. Brücker et al. I n t e r n a t i o n a l J o u r n a l o f B i o c h e m i s t r y a n d C e l l B i o l o g y 129 (2020) 105877 Appelbaum, T., Santana, E., Aguirre, G.D., 2020. Critical decrease in the level of axon Chu, C.W., Ossipova, O., Ioannou, A., Sokol, S.Y., 2016. Prickle3 synergizes with Wtip to guidance receptor ROBO1 in rod synaptic terminals is followed by axon retraction. regulate basal body organization and cilia growth. Sci. Rep. 6, 24104. https://doi. Invest. Ophthalmol. Vis. Sci. 61, 11. https://doi.org/10.1167/iovs.61.3.11. org/10.1038/srep24104. Aragona, M., Panciera, T., Manfrin, A., Giulitti, S., Michielin, F., Elvassore, N., Collin, R.W.J., Safieh, C., Littink, K.W., Shalev, S.A., Garzozi, H.J., Rizel, L., Abbasi, A.H., Dupont, S., Piccolo, S., 2013. A mechanical checkpoint controls multicellular growth Cremers, F.P.M., den Hollander, A.I., Klevering, B.J., Ben-Yosef, T., 2010. Mutations through YAP/TAZ regulation by actin-processing factors. Cell 154, 1047–1059. in C2ORF71 cause autosomal-recessive retinitis pigmentosa. Am. J. Hum. Genet. 86, https://doi.org/10.1016/j.cell.2013.07.042. 783–788. https://doi.org/10.1016/j.ajhg.2010.03.016. Barral, D.C., Garg, S., Casalou, C., Watts, G.F.M., Sandoval, J.L., Ramalho, J.S., Hsu, V. Collin, G.B., Marshall, J.D., King, B.L., Milan, G., Maffei, P., Jagger, D.J., Naggert, J.K., W., Brenner, M.B., 2012. Arl13b regulates endocytic recycling traffic. Proc. Natl. 2012. The alström syndrome protein, ALMS1, interacts with α-actinin and Acad. Sci. U. S. A. 109, 21354–21359. https://doi.org/10.1073/pnas.1218272110. components of the endosome recycling pathway. PLoS One 7, e37925. https://doi. Bergmann, C., 2015. ARPKD and early manifestations of ADPKD: the original polycystic org/10.1371/journal.pone.0037925. kidney disease and phenocopies. Pediatr. Nephrol. 30, 15–30. https://doi.org/ Connell, G., Bascom, R., Molday, L., Reid, D., McInnes, R.R., Molday, R.S., 1991. 10.1007/s00467-013-2706-2. Photoreceptor peripherin is the normal product of the gene responsible for retinal Bershteyn, M., Atwood, S.X., Woo, W.M., Li, M., Oro, A.E., 2010. MIM and cortactin degeneration in the rds mouse. Proc. Natl. Acad. Sci. U. S. A. 88, 723–726. https:// antagonism regulates ciliogenesis and hedgehog signaling. Dev. Cell 19, 270–283. doi.org/10.1073/pnas.88.3.723. https://doi.org/10.1016/j.devcel.2010.07.009. Coon, B.G., Mukherjee, D., Hanna, C.B., Riese, D.J., Lowe, M., Aguilar, R.C., 2009. Lowe Beyer, T., Bolz, S., Junger, K., Horn, N., Moniruzzaman, M., Wissinger, Y., Ueffing, M., syndrome patient fibroblasts display Ocrl1-specific cell migration defects that cannot Boldt, K., 2018. CRISPR/Cas9-mediated genomic editing of Cluap1/IFT38 reveals a be rescued by the homologous Inpp5b phosphatase. Hum. Mol. Genet. 18, new role in actin arrangement. Mol. Cell Proteomics 17, 1285–1294. https://doi. 4478–4491. https://doi.org/10.1093/hmg/ddp407. org/10.1074/mcp.RA117.000487. Coon, B.G., Hernandez, V., Madhivanan, K., Mukherjee, D., Hanna, C.B., Barinaga- Blacque, O.E., Reardon, M.J., Li, C., McCarthy, J., Mahjoub, M.R., Ansley, S.J., Rementeria Ramirez, I., Lowe, M., Beales, P.L., Aguilar, R.C., 2012. The lowe Badano, J.L., Mah, A.K., Beales, P.L., Davidson, W.S., Johnsen, R.C., Audeh, M., syndrome protein OCRL1 is involved in primary cilia assembly. Hum. Mol. Genet. Plasterk, R.H.A., Baillie, D.L., Katsanis, N., Quarmby, L.M., Wicks, S.R., Leroux, M. 21, 1835–1847. https://doi.org/10.1093/hmg/ddr615. R., 2004. Loss of C. elegans BBS-7 and BBS-8 protein function results in cilia defects Copeland, S.J., McRae, A., Guarguaglini, G., Trinkle-Mulcahy, L., Copeland, J.W., 2018. and compromised intraflagellar transport. Genes Dev. 18, 1630–1642. https://doi. Actin-dependent regulation of cilia length by the inverted formin FHDC1. Mol. Biol. org/10.1101/gad.1194004. Cell 29, 1611–1627. https://doi.org/10.1091/mbc.E18-02-0088. Blacque, O.E., Scheidel, N., Kuhns, S., 2018. Rab GTPases in cilium formation and Corkins, M.E., Krneta-Stankic, V., Kloc, M., McCrea, P.D., Gladden, A.B., Miller, R.K., function. Small GTPases 9, 76–94. https://doi.org/10.1080/ 2019. Divergent roles of the Wnt/PCP Formin Daam1 in renal ciliogenesis. PLoS One 21541248.2017.1353847. 14, e0221698. https://doi.org/10.1371/journal.pone.0221698. Bloodgood, R.A., 2010. Sensory reception is an attribute of both primary cilia and motile Corral-serrano, J.C., Lamers, I.J.C., Van Reeuwijk, J., Duijkers, L., Hoogendoorn, A.D.M., cilia. J. Cell. Sci. 123, 505–509. https://doi.org/10.1242/jcs.066308. Yildirim, A., Argyrou, N., Ruigrok, R.A.A., Letteboer, J.F., Butcher, R., Van Essen, M. Bompard, G., Sharp, S.J., Freiss, G., Machesky, L.M., 2005. Involvement of Rac in actin D., Sakami, S., Palczewski, K., Cheetham, M.E., Liu, Q., Boldt, K., Ueffing, M., cytoskeleton rearrangements induced by MIM-B. J. Cell. Sci. 118, 5393–5403. Garanto, A., 2020. PCARE and WASF3 regulate ciliary F-actin assembly that is https://doi.org/10.1242/jcs.02640. required for the initiation of photoreceptor outer segment disk formation. Proc. Natl. Boutin, C., Labedan, P., Dimidschstein, J., Richard, F., Cremer, H., André, P., Yang, Y., Acad. Sci. U. S. A. 117, 9922–9931. https://doi.org/10.1073/pnas.1903125117. Montcouquiol, M., Goffinet, A.M., Tissir, F., 2014. A dual role for planar cell polarity Cui, C., Chatterjee, B., Lozito, T.P., Zhang, Z., Francis, R.J., Yagi, H., Swanhart, L.M., genes in ciliated cells. Proc. Natl. Acad. Sci. U. S. A. 111, E3129–3138. https://doi. Sanker, S., Francis, D., Yu, Q., San Agustin, J.T., Puligilla, C., Chatterjee, T., org/10.1073/pnas.1404988111. Tansey, T., Liu, X., Kelley, M.W., Spiliotis, E.T., Kwiatkowski, A.V., Tuan, R., Bujakowska, K.M., Liu, Q., Pierce, E.A., 2017. Photoreceptor cilia and retinal Pazour, G.J., Hukriede, N.A., Lo, C.W., 2013. Wdpcp, a PCP protein required for ciliopathies. Cold Spring Harb. Perspect. Biol. 9, a028274. https://doi.org/10.1101/ ciliogenesis, regulates directional cell migration and cell polarity by direct cshperspect.a028274. modulation of the actin cytoskeleton. PLoS Biol. 11, e1001720. https://doi.org/ Bulloj, A., Duan, W., Finnemann, S.C., 2013. PI 3-kinase independent role for AKT in F- 10.1371/journal.pbio.1001720. actin regulation during outer segment phagocytosis by RPE cells. Exp. Eye Res. 113, Das, A., Fischer, R.S., Pan, D., Waterman, C.M., 2016. YAP nuclear localization in the 9–18. https://doi.org/10.1016/j.exer.2013.05.002. absence of cell-cell contact is mediated by a filamentous actin-dependent, Myosin Bulloj, A., Maminishkis, A., Mizui, M., Finnemann, S.C., 2018. Semaphorin4D-PlexinB1 IIand Phospho-YAP-independent pathway during extracellular matrix signaling attenuates photoreceptor outer segment phagocytosis by reducing Rac1 mechanosensing. J. Biol. Chem. 291, 6096–6110. https://doi.org/10.1074/jbc. activity of RPE cells. Mol. Neurobiol. 55, 4320–4332. https://doi.org/10.1007/ M115.708313. s12035-017-0649-5. Davenport, J.R., Watts, A.J., Roper, V.C., Croyle, M.J., van Groen, T., Wyss, J.M., Cantero, M.D.R., Cantiello, H.F., 2015. Polycystin-2 (TRPP2) regulation by Ca2+ is Nagy, T.R., Kesterson, R.A., Yoder, B.K., 2007. Disruption of intraflagellar transport effected and diversified by actin-binding proteins. Biophys. J. 108, 2191–2200. in adult mice leads to obesity and slow-onset cystic kidney disease. Curr. Biol. 17, https://doi.org/10.1016/j.bpj.2015.03.050. 1586–1594. https://doi.org/10.1016/j.cub.2007.08.034. Cao, J., Shen, Y., Zhu, L., Xu, Y., Zhou, Y., Wu, Z., Li, Y., Yan, X., Zhu, X., 2012. MiR-129- Dawe, H.R., Adams, M., Wheway, G., Szymanska, K., Logan, C.V., Noegel, A.A., Gull, K., 3p controls cilia assembly by regulating CP110 and actin dynamics. Nat. Cell Biol. Johnson, C.A., 2009. Nesprin-2 interacts with meckelin and mediates ciliogenesis via 14, 697–706. https://doi.org/10.1038/ncb2512. remodelling of the actin cytoskeleton. J. Cell. Sci. 122, 2716–2726. https://doi.org/ Cao, J., Ehling, M., März, S., Seebach, J., Tarbashevich, K., Sixta, T., Pitulescu, M.E., 10.1242/jcs.043794. Werner, A.C., Flach, B., Montanez, E., Raz, E., Adams, R.H., Schnittler, H., 2017. Delgehyr, N., Sillibourne, J., Bornens, M., 2005. Microtubule nucleation and anchoring Polarized actin and VE-cadherin dynamics regulate junctional remodelling and cell at the centrosome are independent processes linked by ninein function. J. Cell. Sci. migration during sprouting angiogenesis. Nat. Commun. 8, 2210. https://doi.org/ 118, 1565–1575. https://doi.org/10.1242/jcs.02302. 10.1038/s41467-017-02373-8. Deretic, D., Traverso, V., Parkins, N., Jackson, F., Rodriguez De Turco, E.B., Ransom, N., Caron, A., Xu, X., Lin, X., 2012. Wnt/β-catenin signaling directly regulates Foxj1 2004. Phosphoinositides, ezrin/moesin, and rac1 regulate fusion of rhodopsin expression and ciliogenesis in zebrafish Kupffer’s vesicle. Development 139, transport carriers in retinal photoreceptors. Mol. Biol. Cell 15, 359–370. https://doi. 514–524. https://doi.org/10.1242/dev.071746. org/10.1091/mbc.E03-04-0203. Carvajal-Gonzalez, J.M., Roman, A.C., Mlodzik, M., 2016. Positioning of centrioles is a DeVera, C., Tosini, G., 2020. Circadian analysis of the mouse retinal pigment epithelium conserved readout of Frizzled planar cell polarity signalling. Nat. Commun. 7, transcriptome. Exp. Eye Res. 193, 107988. https://doi.org/10.1016/j. 11135. https://doi.org/10.1038/ncomms11135. exer.2020.107988. Cevik, S., Hori, Y., Kaplan, O.I., Kida, K., Toivenon, T., Foley-Fisher, C., Cottell, D., Devlin, L.A., Sayer, J.A., 2019. Renal ciliopathies. Curr. Opin. Genet. Dev. 56, 49–60. Katada, T., Kontani, K., Blacque, O.E., 2010. Joubert syndrome Arl13b functions at https://doi.org/10.1016/j.gde.2019.07.005. ciliary membranes and stabilizes protein transport in Caenorhabditis elegans. J. Cell Digilio, M.C., Gnazzo, M., Lepri, F., Dentici, M.L., Pisaneschi, E., Baban, A., Passarelli, C., Biol. 188, 953–969. https://doi.org/10.1083/jcb.200908133. Capolino, R., Angioni, A., Novelli, A., Marino, B., Dallapiccola, B., 2017. Congenital Cha, H.J., Jeong, M.J., Kleinman, H.K., 2003. Role of thymosin β4 in tumor metastasis heart defects in molecularly proven Kabuki syndrome patients. Am. J. Med. Genet. and angiogenesis. J. Natl. Cancer Inst. 95, 1674–1680. https://doi.org/10.1093/ Part A 173, 2912–2922. https://doi.org/10.1002/ajmg.a.38417. jnci/djg100. Dilan, T.L., Singh, R.K., Saravanan, T., Moye, A., Goldberg, A.F.X., Stoilov, P., Chaitin, M.H., Schneider, B.G., Hall, M.O., Papermaster, D.S., 1984. Actin in the Ramamurthy, V., 2018. Bardet-Biedl syndrome-8 (BBS8) protein is crucial for the photoreceptor connecting cilium: immunocytochemical localization to the site of development of outer segments in photoreceptor neurons. Hum. Mol. Genet. 27, outer segment disk formation. J. Cell Biol. 99, 239–247. https://doi.org/10.1083/ 283–294. https://doi.org/10.1093/hmg/ddx399. jcb.99.1.239. Dollar, G., Gombos, R., Barnett, A.A., Hernandez, D.S., Maung, S.M.T., Mihály, J., Chen, J., Knowles, H.J., Hebert, J.L., Hackett, B.P., 1998. Mutation of the mouse Jenny, A., 2016. Unique and overlapping functions of formins frl and DAAM during hepatocyte nuclear factor/forkhead homologue 4 gene results in an absence of cilia ommatidial rotation and neuronal development in Drosophila. Genetics 202, and random left-right asymmetry. J. Clin. Invest. 102, 1077–1082. https://doi.org/ 1135–1151. https://doi.org/10.1534/genetics.115.181438. 10.1172/JCI4786. Dominguez, R., Holmes, K.C., 2011. Actin structure and function. Annu. Rev. Biophys. Chevalier, B., Adamiok, A., Mercey, O., Revinski, D.R., Zaragosi, L.E., Pasini, A., 40, 169–186. https://doi.org/10.1146/annurev-biophys-042910-155359. Kodjabachian, L., Barbry, P., Marcet, B., 2015. MiR-34/449 control apical actin Drummond, M.L., Li, M., Tarapore, E., Nguyen, T.T.L., Barouni, B.J., Cruz, S., Tan, K.C., network formation during multiciliogenesis through small GTPase pathways. Nat. Oro, A.E., Atwood, S.X., 2018. Actin polymerization controls cilia-mediated Commun. 6, 8386. https://doi.org/10.1038/ncomms9386. signaling. J. Cell Biol. 217, 3255–3266. https://doi.org/10.1083/jcb.201703196. 10 L. Brücker et al. I n t e r n a t i o n a l J o u r n a l o f B i o c h e m i s t r y a n d C e l l B i o l o g y 129 (2020) 105877 Estrada-Cuzcano, A., Roepman, R., Cremers, F.P.M., Hollander, A.I.D., Mans, D.A., 2012. Huang, F., Sirinakis, G., Allgeyer, E.S., Schroeder, L.K., Duim, W.C., Kromann, E.B., Non-syndromic retinal ciliopathies: translating gene discovery into therapy. Hum. Phan, T., Rivera-Molina, F.E., Myers, J.R., Irnov, I., Lessard, M., Zhang, Y., Mol. Genet. 21, 111–124. https://doi.org/10.1093/hmg/dds298. Handel, M.A., Jacobs-Wagner, C., Lusk, C.P., Rothman, J.E., Toomre, D., Booth, M.J., Farina, F., Gaillard, J., Guérin, C., Couté, Y., Sillibourne, J., Blanchoin, L., Théry, M., Bewersdorf, J., 2016. Ultra-high resolution 3D imaging of whole cells. Cell 166, 2016. The centrosome is an actin-organizing centre. Nat. Cell Biol. 18, 65–75. 1028–1040. https://doi.org/10.1016/j.cell.2016.06.016. https://doi.org/10.1038/ncb3285. Huang, N., Xia, Y., Zhang, D., Wang, S., Bao, Y., He, R., Teng, J., Chen, J., 2017. Fontainhas, A.M., Townes-Anderson, E., 2011. RhoA inactivation prevents photoreceptor Hierarchical assembly of centriole subdistal appendages via centrosome binding axon retraction in an in vitro model of acute retinal detachment. Investig. proteins CCDC120 and CCDC68. Nat. Commun. 8, 15057. https://doi.org/10.1038/ Ophthalmol. Vis. Sci. 52, 579–587. https://doi.org/10.1167/iovs.10-5744. ncomms15057. Forsythe, E., Kenny, J., Bacchelli, C., Beales, P.L., 2018. Managing Bardet-Biedl Ishikawa, H., Marshall, W.F., 2017. Intraflagellar transport and ciliary dynamics. Cold syndrome-now and in the future. Front. Pediatr. 6, 23. https://doi.org/10.3389/ Spring Harb. Perspect. Biol. 9, a021998. https://doi.org/10.1101/cshperspect. fped.2018.00023. a021998. Fraser, A.M., Davey, M.G., 2019. TALPID3 in Joubert syndrome and related ciliopathy Ishikawa, H., Thompson, J., Yates, J.R., Marshall, W.F., 2012. Proteomic analysis of disorders. Curr. Opin. Genet. Dev. 56, 41–48. https://doi.org/10.1016/j. mammalian primary cilia. Curr. Biol. 22, 414–419. https://doi.org/10.1016/j. gde.2019.06.010. cub.2012.01.031. Fuertes-Alvarez, S., Maeso-Alonso, L., Villoch-Fernandez, J., Wildung, M., Martin- Jagger, D.J., Forge, A., 2012. Assessing PCP in the cochlea of mammalian ciliopathy Lopez, M., Marshall, C., Villena-Cortes, A.J., Diez-Prieto, I., Pietenpol, J.A., Tissir, F., models. Methods Mol. Biol. 839, 239–248. https://doi.org/10.1007/978-1-61779- Lizé, M., Marques, M.M., Marin, M.C., 2018. p73 regulates ependymal planar cell 510-7_19. polarity by modulating actin and microtubule cytoskeleton. Cell Death Dis. 9, 1183. Jagger, D., Collin, G., Kelly, J., Towers, E., Nevill, G., Longo-Guess, C., Benson, J., https://doi.org/10.1038/s41419-018-1205-6. Halsey, K., Dolan, D., Marshall, J., Naggert, J., Forge, A., 2011. Alström Syndrome Gakovic, M., Shu, X., Kasioulis, I., Carpanini, S., Moraga, I., Wright, A.F., 2011. The role protein ALMS1 localizes to basal bodies of cochlear hair cells and regulates cilium- of RPGR in cilia formation and actin stability. Hum. Mol. Genet. 20, 4840–4850. dependent planar cell polarity. Hum. Mol. Genet. 20, 466–481. https://doi.org/ https://doi.org/10.1093/hmg/ddr423. 10.1093/hmg/ddq493. Gallagher, A.R., Cedzich, A., Gretz, N., Somlo, S., Witzgall, R., 2000. The polycystic Jain, R., Javidan-Nejad, C., Alexander-Brett, J., Horani, A., Cabellon, M.C., Walter, M.J., kidney disease protein PKD2 interacts with Hax-1, a protein associated with the actin Brody, S.L., 2012. Sensory functions of motile cilia and implication for cytoskeleton. Proc. Natl. Acad. Sci. U. S. A. 97, 4017–4022. https://doi.org/ bronchiectasis. Front. Biosci. - Sch. 4, 1088–1098. https://doi.org/10.2741/s320. 10.1073/pnas.97.8.4017. Jones, C., Roper, V.C., Foucher, I., Qian, D., Banizs, B., Petit, C., Yoder, B.K., Chen, P., Gerdes, J.M., Liu, Y., Zaghloul, N.A., Leitch, C.C., Lawson, S.S., Kato, M., Beachy, P.A., 2008. Ciliary proteins link basal body polarization to planar cell polarity regulation. Beales, P.L., DeMartino, G.N., Fisher, S., Badano, J.L., Katsanis, N., 2007. Disruption Nat. Genet. 40, 69–77. https://doi.org/10.1038/ng.2007.54. of the basal body compromises proteasomal function and perturbs intracellular Wnt Juan, T., Géminard, C., Coutelis, J.B., Cerezo, D., Polès, S., Noselli, S., Fürthauer, M., response. Nat. Genet. 39, 1350–1360. https://doi.org/10.1038/ng.2007.12. 2018. Myosin1D is an evolutionarily conserved regulator of animal left-right Gerondopoulos, A., Strutt, H., Stevenson, N.L., Sobajima, T., Levine, T.P., Stephens, D.J., asymmetry. Nat. Commun. 9, 1942. https://doi.org/10.1038/s41467-018-04284-8. Strutt, D., Barr, F.A., 2019. Planar cell polarity effector proteins inturned and fuzzy Kang, G.M., Han, Y., Ko, H.W., Kim, J., Chul Oh, B., Kwon, I., Kim, M.S., 2015. Leptin form a Rab23 GEF complex. Curr. Biol. 29, 3323–3330. https://doi.org/10.1016/j. elongates hypothalamic neuronal cilia via transcriptional regulation and actin cub.2019.07.090. destabilization. J. Biol. Chem. 290, 18146–18155. https://doi.org/10.1074/jbc. Goetz, S.C., Anderson, K.V., 2010. The primary cilium: a signalling centre during M115.639468. vertebrate development. Nat. Rev. Genet. https://doi.org/10.1038/nrg2774. Kevany, B.M., Zhang, N., Jastrzebska, B., Palczewski, K., 2015. Animals deficient in Gonçalves, J., Sharma, A., Coyaud, É., Laurent, E.M.N., Raught, B., Pelletier, L., 2020. C2Orf71, an autosomal recessive retinitis pigmentosa-associated locus, develop LUZP1 and the tumor suppressor EPLIN modulate actin stability to restrict primary severe early-onset retinal degeneration. Hum. Mol. Genet. 24, 2627–2640. https:// cilia formation. J. Cell Biol. 219 https://doi.org/10.1083/JCB.201908132. doi.org/10.1093/hmg/ddv025. Gong, Y., Mo, C., Fraser, S.E., 2004. Planar cell polarity signalling controls cell division Kiesel, P., Alvarez Viar, G., Tsoy, N., Maraspini, R., Gorilak, P., Varga, V., orientation during zebrafish gastrulation. Nature 430, 689–693. https://doi.org/ Honigmann, A., Pigino, G., 2020. The molecular structure of mammalian primary 10.1038/nature02796. cilia revealed by cryo-electron tomography. Nat. Struct. Mol. Biol. 1–10. https://doi. Haag, N., Schüler, S., Nietzsche, S., Hübner, C.A., Strenzke, N., Qualmann, B., Kessels, M. org/10.1038/s41594-020-0507-4. M., 2018. The actin nucleator cobl is critical for centriolar positioning, postnatal Kim, J., Lee, J.E., Heynen-Genel, S., Suyama, E., Ono, K., Lee, K., Ideker, T., Aza- planar cell polarity refinement, and function of the cochlea. Cell Rep. 24, Blanc, P., Gleeson, J.G., 2010. Functional genomic screen for modulators of 2418–2431. https://doi.org/10.1016/j.celrep.2018.07.087. ciliogenesis and cilium length. Nature 464, 1048–1051. https://doi.org/10.1038/ Habas, R., Kato, Y., He, X., 2001. Wnt/Frizzled activation of Rho regulates vertebrate nature08895. gastrulation and requires a novel formin homology protein Daam1. Cell 107, Kim, S.K., Shindo, A., Park, T.J., Oh, E.C., Ghosh, S., Gray, R.S., Lewis, R.A., Johnson, C. 843–854. https://doi.org/10.1016/S0092-8674(01)00614-6. A., Attie-Bittach, T., Katsanis, N., Wallingford, J.B., 2010. Planar cell polarity acts Han, Y.G., Kim, H.J., Dlugosz, A.A., Ellison, D.W., Gilbertson, R.J., Alvarez-Buylla, A., through septins to control collective cell movement and ciliogenesis. Science 80 2009. Dual and opposing roles of primary cilia in medulloblastoma development. (329), 1337–1340. https://doi.org/10.1126/science.1191184. Nat. Med. 15, 1062–1065. https://doi.org/10.1038/nm.2020. Kim, H.Y., Davidson, L.A., 2011. Punctuated actin contractions during convergent Han, Y.M., Kang, G.M., Byun, K., Ko, H.W., Kim, J., Shin, M.S., Kim, H.K., Gil, S.Y., Yu, J. extension and their permissive regulation by the non-canonical Wnt-signaling H., Lee, B., Kim, M.S., 2014. Leptin-promoted cilia assembly is critical for normal pathway. J. Cell. Sci. 124, 635–646. https://doi.org/10.1242/jcs.067579. energy balance. J. Clin. Invest. 124, 2193–2197. https://doi.org/10.1172/JCI69395. Kim, J., Jung, Y., 2016. Thymosin Beta 4 Is a potential regulator of hepatic stellate Cells. Harris, J.A., Van De Weghe, J.M., Kubo, T., Witman, G.B., Lechtreck, K., 2020. Diffusion Vitamins and Hormones. Academic Press Inc, pp. 121–149. https://doi.org/ rather than IFT provides most of the tubulin required for axonemal assembly. J. Cell. 10.1016/bs.vh.2016.04.011. Sci. https://doi.org/10.1242/jcs.249805. Kim, G.W., Li, L., Gorbani, M., You, L., Yang, X.J., 2013. Mice lacking α-tubulin Hartill, V., Szymanska, K., Sharif, S.M., Wheway, G., Johnson, C.A., 2017. Meckel-Gruber acetyltransferase 1 are viable but display α-tubulin acetylation deficiency and syndrome: an update on diagnosis, clinical management, and research advances. dentate gyrus distortion. J. Biol. Chem. 288, 20334–20350. https://doi.org/ Front. Pediatr. 5, 244. https://doi.org/10.3389/fped.2017.00244. 10.1074/jbc.M113.464792. Hernandez-Hernandez, V., Pravincumar, P., Diaz-Font, A., May-Simera, H., Jenkins, D., Kim, Jongshin, Jo, H., Hong, H., Kim, M.H., Kim, J.M., Lee, J.K., Do Heo, W., Kim, Joon, Knight, M., Beales, P.L., 2013. Bardet-biedl syndrome proteins control the cilia 2015. Actin remodelling factors control ciliogenesis by regulating YAP/TAZ activity length through regulation of actin polymerization. Hum. Mol. Genet. 22, and vesicle trafficking. Nat. Commun. 6, 6781. https://doi.org/10.1038/ 3858–3868. https://doi.org/10.1093/hmg/ddt241. ncomms7781. Hewage, N., Altman, D., 2018. A role for myosin VI in retinal pigment epithelium Kim, S., Nie, H., Nesin, V., Tran, U., Outeda, P., Bai, C.X., Keeling, J., Maskey, D., phagocytosis. Biochem. Biophys. Res. Commun. 504, 759–764. https://doi.org/ Watnick, T., Wessely, O., Tsiokas, L., 2016. The polycystin complex mediates Wnt/ 10.1016/j.bbrc.2018.09.006. Ca2+ signalling. Nat. Cell Biol. 18, 752–764. https://doi.org/10.1038/ncb3363. Hoang-Minh, L.B., Deleyrolle, L.P., Siebzehnrubl, D., Ugartemendia, G., Futch, H., Kirjavainen, A., Laos, M., Anttonen, T., Pirvola, U., 2015. The Rho GTPase Cdc42 Griffith, B., Breunig, J.J., De Leon, G., Mitchell, D.A., Semple-Rowland, S., regulates hair cell planar polarity and cellular patterning in the developing cochlea. Reynolds, B.A., Sarkisian, M.R., 2016. Disruption of KIF3A in patient-derived Biol. Open 4, 516–526. https://doi.org/10.1242/bio.20149753. glioblastoma cells: effects on ciliogenesis, hedgehog sensitivity, and tumorigenesis. Kobayashi, T., Okada, F., Fujii, N., Tomita, N., Ito, S., Tazawa, H., Aoyama, T., Choi, S.K., Oncotarget 7, 7029–7043. https://doi.org/10.18632/oncotarget.6854. Shibata, T., Fujita, H., Hosokawa, M., 2002. Thymosin-β4 regulates motility and Hoang-Minh, L.B., Dutra-Clarke, M., Breunig, J.J., Sarkisian, M.R., 2018. Glioma cell metastasis of malignant mouse fibrosarcoma cells. Am. J. Pathol. 160, 869–882. proliferation is enhanced in the presence of tumor-derived cilia vesicles. Cilia 7, 6. https://doi.org/10.1016/S0002-9440(10)64910-3. https://doi.org/10.1186/s13630-018-0060-5. Kobayashi, T., Kim, S., Lin, Y.C., Inoue, T., Dynlacht, B.D., 2014. The CP110-interacting Hogan, M.C., Manganelli, L., Woollard, J.R., Masyuk, A.I., Masyuk, T.V., proteins talpid3 and cep290 play overlapping and distinct roles in cilia assembly. Tammachote, R., Huang, B.Q., Leontovich, A.A., Beito, T.G., Madden, B.J., J. Cell Biol. 204, 215–229. https://doi.org/10.1083/jcb.201304153. Charlesworth, M.C., Torres, V.E., Larusso, N.F., Harris, P.C., Ward, C.J., 2009. Kohli, P., Höhne, M., Jüngst, C., Bertsch, S., Ebert, L.K., Schauss, A.C., Benzing, T., Characterization of PKD protein-positive exosome-like vesicles. J. Am. Soc. Nephrol. Rinschen, M.M., Schermer, B., 2017. The ciliary membrane-associated proteome 20, 278–288. https://doi.org/10.1681/ASN.2008060564. reveals actin-binding proteins as key components of cilia. EMBO Rep. 18, Hong, H., Kiim, J., Kim, J., 2015. Myosin heavy chain 10 (MYH10) is required for 1521–1535. https://doi.org/10.15252/embr.201643846. centriole migration during the biogenesis of primary cilia. Biochem. Biophys. Res. Kozminski, K.G., Johnson, K.A., Forscher, P., Rosenbaum, J.L., 1993. A motility in the Commun. 461, 180–185. https://doi.org/10.1016/j.bbrc.2015.04.028. eukaryotic flagellum unrelated to flagellar beating. Proc. Natl. Acad. Sci. U. S. A. 90, 5519–5523. https://doi.org/10.1073/pnas.90.12.5519. 11 L. Brücker et al. I n t e r n a t i o n a l J o u r n a l o f B i o c h e m i s t r y a n d C e l l B i o l o g y 129 (2020) 105877 Kretschmer, V., Patnaik, S.R., Kretschmer, F., Chawda, M.M., Hernandez-Hernandez, V., May-Simera, H., Nagel-Wolfrum, K., Wolfrum, U., 2017. Cilia - the sensory antennae in May-Simera, H.L., 2019. Progressive characterization of visual phenotype in bardet- the eye. Prog. Retin. Eye Res. 60, 144–180. https://doi.org/10.1016/j. biedl syndrome mutant mice. Investig. Ophthalmol. Vis. Sci. 60, 1132–1143. https:// preteyeres.2017.05.001. doi.org/10.1167/iovs.18-25210. May-Simera, H.L., Wan, Q., Jha, B.S., Hartford, J., Khristov, V., Dejene, R., Chang, J., Lee, L., 2011. Mechanisms of mammalian ciliary motility: insights from primary ciliary Patnaik, S., Lu, Q., Banerjee, P., Silver, J., Insinna-Kettenhofen, C., Patel, D., dyskinesia genetics. Gene 473, 57–66. https://doi.org/10.1016/j.gene.2010.11.006. Lotfi, M., Hotaling, May, Malicdan, N., Maminishkis, A., Sridharan, R., Brooks, B., Lee, J.W., Ryu, Y.K., Ji, Y.H., Kang, J.H., Moon, E.Y., 2015. Hypoxia/reoxygenation- Miyagishima, K., Gunay-Aygun, M., Pal, R., Westlake, C., Miller, S., Sharma, R., experienced cancer cell migration and metastasis are regulated by Rap1-and Rac1- Bharti, K., 2018. Primary Cilium Mediated Retinal Pigment Epithelium Maturation is GTPase activation via the expression of thymosin beta-4. Oncotarget 6, 9820–9833. Retarded in Ciliopathy Patient Cells. CellReports 22, 189–205. https://doi.org/ https://doi.org/10.18632/oncotarget.3218. 10.1016/j.celrep.2017.12.038. Lee, S., Tan, H.Y., Geneva, I.I., Kruglov, A., Calvert, P.D., 2018. Actin filaments partition Mazzoni, F., Safa, H., Finnemann, S.C., 2014. Understanding photoreceptor outer primary cilia membranes into distinct fluid corrals. J. Cell Biol. 217, 2831–2849. segment phagocytosis: use and utility of RPE cells in culture. Exp. Eye Res. 126, https://doi.org/10.1083/jcb.201711104. 51–60. https://doi.org/10.1016/j.exer.2014.01.010. Lee, J.W., Kim, H.S., Moon, E.Y., 2019. Thymosin β-4 is a novel regulator for primary McMurray, R.J., Wann, A.K.T., Thompson, C.L., Connelly, J.T., Knight, M.M., 2013. cilium formation by nephronophthisis 3 in HeLa human cervical cancer cells. Sci. Surface topography regulates wnt signaling through control of primary cilia Rep. 9, 1–11. https://doi.org/10.1038/s41598-019-43235-1. structure in mesenchymal stem cells. Sci. Rep. 3, 3545. https://doi.org/10.1038/ Li, Q., Montalbetti, N., Shen, P.Y., Dai, X.Q., Cheeseman, C.I., Karpinski, E., Wu, G., srep03545. Cantiello, H.F., Chen, X.Z., 2005. Alpha-actinin associates with polycystin-2 and Megaw, R., Hurd, T.W., 2018. Photoreceptor actin dysregulation in syndromic and non- regulates its channel activity. Hum. Mol. Genet. 14, 1587–1603. https://doi.org/ syndromic retinitis pigmentosa. Biochem. Soc. Trans. 46, 1463–1473. https://doi. 10.1093/hmg/ddi167. org/10.1042/BST20180138. Liang, Y., Meng, D., Zhu, B., Pan, J., 2016. Mechanism of ciliary disassembly. Cell. Mol. Megaw, R., Abu-Arafeh, H., Jungnickel, M., Mellough, C., Gurniak, C., Witke, W., Life Sci. 73, 1787–1802. https://doi.org/10.1007/s00018-016-2148-7. Zhang, W., Khanna, H., Mill, P., Dhillon, B., Wright, A.F., Lako, M., Ffrench- Lienkamp, S., Ganner, A., Walz, G., 2012. Inversin, Wnt signaling and primary cilia. Constant, C., 2017. Gelsolin dysfunction causes photoreceptor loss in induced Differentiation 83, S49–S55. https://doi.org/10.1016/j.diff.2011.11.012. pluripotent cell and animal retinitis pigmentosa models. Nat. Commun. 8, 271. Lin, J., Liu, J., Wang, Y., Zhu, J., Zhou, K., Smith, N., Zhan, X., 2005. Differential https://doi.org/10.1038/s41467-017-00111-8. regulation of cortactin and N-WASP-mediated actin polymerization by missing in Mercey, O., Kodjabachian, L., Barbry, P., Marcet, B., 2016. MicroRNAs as key regulators metastasis (MIM) protein. Oncogene 24, 2059–2066. https://doi.org/10.1038/sj. of GTPase-mediated apical actin reorganization in multiciliated epithelia. Small onc.1208412. GTPases 7, 54–58. https://doi.org/10.1080/21541248.2016.1151099. Liu, W., Sato, A., Khadka, D., Bharti, R., Diaz, H., Runnels, L.W., Habas, R., 2008. Mick, D.U., Rodrigues, R.B., Leib, R.D., Adams, C.M., Chien, A.S., Gygi, S.P., Nachury, M. Mechanism of activation of the Formin protein Daam1. Proc. Natl. Acad. Sci. U. S. A. V., 2015. Proteomics of primary cilia by proximity labeling. Dev. Cell 35, 497–512. 105, 210–215. https://doi.org/10.1073/pnas.0707277105. https://doi.org/10.1016/j.devcel.2015.10.015. Louer, E.M.M., Günzel, D., Rosenthal, R., Carmone, C., Yi, G., Stunnenberg, H.G., den Minegishi, K., Hashimoto, M., Ajima, R., Takaoka, K., Shinohara, K., Ikawa, Y., Hollander, A.I., Deen, P.M.T., 2020. Differential day-night expression of tight Nishimura, H., McMahon, A.P., Willert, K., Okada, Y., Sasaki, H., Shi, D., junction components in murine retinal pigment epithelium. Exp. Eye Res. 193, Fujimori, T., Ohtsuka, T., Igarashi, Y., Yamaguchi, T.P., Shimono, A., Shiratori, H., 107985. https://doi.org/10.1016/j.exer.2020.107985. Hamada, H., 2017. A Wnt5 activity asymmetry and intercellular signaling via PCP Lu, Q., Insinna, C., Ott, C., Stauffer, J., Pintado, P.A., Rahajeng, J., Baxa, U., Walia, V., proteins polarize node cells for left-right symmetry breaking. Dev. Cell 40, 439–452. Cuenca, A., Hwang, Y.S., Daar, I.O., Lopes, S., Lippincott-Schwartz, J., Jackson, P.K., https://doi.org/10.1016/j.devcel.2017.02.010. Caplan, S., Westlake, C.J., 2015. Early steps in primary cilium assembly require Mirvis, M., Siemers, K.A., Nelson, W.J., Stearns, T.P., 2019. Primary cilium loss in EHD1/EHD3-dependent ciliary vesicle formation. Nat. Cell Biol. 17, 228–240. mammalian cells occurs predominantly by whole-cilium shedding. PLoS Biol. 17, https://doi.org/10.1038/ncb3109. e3000381. https://doi.org/10.1371/journal.pbio.3000381. Lu, Z., Hu, X., Liu, F., Soares, D.C., Liu, X., Yu, S., Gao, M., Han, S., Qin, Y., Li, C., Molla-Herman, A., Ghossoub, R., Blisnick, T., Meunier, A., Serres, C., Silbermann, F., Jiang, T., Luo, D., Guo, A.Y., Tang, Z., Liu, M., 2017. Ablation of EYS in zebrafish Emmerson, C., Romeo, K., Bourdoncle, P., Schmitt, A., Saunier, S., Spassky, N., causes mislocalisation of outer segment proteins, F-actin disruption and cone-rod Bastin, P., Benmerah, A., 2010. The ciliary pocket: an endocytic membrane domain dystrophy. Sci. Rep. 7, 46098. https://doi.org/10.1038/srep46098. at the base of primary and motile cilia. J. Cell. Sci. 123, 1785–1795. https://doi.org/ Luo, N., West, C.C., Murga-Zamalloa, C.A., Sun, L., Anderson, R.M., Wells, C.D., 10.1242/jcs.059519. Weinreb, R.N., Travers, J.B., Khanna, H., Sun, Y., 2012. OCRL localizes to the Montcouquiol, M., Rachel, R.A., Lanford, P.J., Copeland, N.G., Jenkins, N.A., Kelley, M. primary cilium: a new role for cilia in Lowe syndrome. Hum. Mol. Genet. 21, W., 2003. Identification of Vangl2 and Scrb1 as planar polarity genes in mammals. 3333–3344. https://doi.org/10.1093/hmg/dds163. Nature 423, 173–177. https://doi.org/10.1038/nature01618. Luo, Wwei, Chen, B.J., Wang, Ymei, Yang, Jmei, Liu, X., Yuan, Ysheng, Lin, X., Chi, Flu, Moshiri, A., Humpal, D., Leonard, B.C., Imai, D.M., Tham, A., Bower, L., Clary, D., Chen, P., Ren, Ddong, 2020. Planar cell polarity governs the alignment of the Glaser, T.M., Lloyd, K.C.K., Murphy, C.J., 2017. Arap1 deficiency causes nasopharyngeal epithelium in mammals. FEBS J. https://doi.org/10.1111/ photoreceptor degeneration in mice. Investig. Ophthalmol. Vis. Sci. 58, 1709–1718. febs.15425. https://doi.org/10.1167/iovs.16-20062. Lyraki, R., Lokaj, M., Soares, D.C., Little, A., Vermeren, M., Marsh, J.A., Wittinghofer, A., Müller, C., Charniga, C., Temple, S., Finnemann, S.C., 2018. Quantified F-Actin Hurd, T., 2018. Characterization of a novel RP2-OSTF1 interaction and its morphology is predictive of phagocytic capacity of stem cell-derived retinal pigment implication for actin remodelling. J. Cell. Sci. 131, 211748. https://doi.org/ epithelium. Stem Cell Re. 10, 1075–1087. https://doi.org/10.1016/j. 10.1242/jcs.211748. stemcr.2018.01.017. Madhivanan, K., Mukherjee, D., Claudio Aguilar, R., 2012. Lowe syndrome: Between Nagai, T., Mizuno, K., 2017. Jasplakinolide induces primary cilium formation through primary cilia assembly and Rac1-mediated membrane remodeling. Commun. Integr. cell rounding and YAP inactivation. PLoS One 12, e0183030. https://doi.org/ Biol. 5, 641–644. https://doi.org/10.4161/cib.21952. 10.1371/journal.pone.0183030. Marshall, C.B., Mays, D.J., Beeler, J.S., Rosenbluth, J.M., Boyd, K.L., Santos Guasch, G.L., Nagaoka, T., Furuse, M., Ohtsuka, T., Tsuchida, K., Kishi, M., 2019. Vangl2 interaction Shaver, T.M., Tang, L.J., Liu, Q., Shyr, Y., Venters, B.J., Magnuson, M.A., plays a role in the proteasomal degradation of Prickle2. Sci. Rep. 9, 2912. https:// Pietenpol, J.A., 2016. P73 is required for multiciliogenesis and regulates the Foxj1- doi.org/10.1038/s41598-019-39642-z. Associated gene network. Cell Rep. 14, 2289–2300. https://doi.org/10.1016/j. Nager, A.R., Goldstein, J.S., Herranz-Pérez, V., Portran, D., Ye, F., Garcia-Verdugo, J.M., celrep.2016.02.035. Nachury, M.V., 2017. An actin network dispatches ciliary GPCRs into extracellular Mathewson, A.W., Berman, D.G., Moens, C.B., 2019. Microtubules are required for the vesicles to modulate signaling. Cell 168, 252–263. https://doi.org/10.1016/j. maintenance of planar cell polarity in monociliated floorplate cells. Dev. Biol. 452, cell.2016.11.036. 21–33. https://doi.org/10.1016/j.ydbio.2019.04.007. Namba, T., Ishihara, S., 2020. Cytoskeleton polarity is essential in determining Mattes, B., Dang, Y., Greicius, G., Kaufmann, L.T., Prunsche, B., Rosenbauer, J., orientational order in basal bodies of multi-ciliated cells. PLoS Comput. Biol. 16, Stegmaier, J., Mikut, R., Özbek, S., Nienhaus, G.U., Schug, A., Virshup, D.M., e1007649. https://doi.org/10.1371/journal.pcbi.1007649. Scholpp, S., 2018. Wnt/PCP controls spreading of Wnt/β-catenin signals by Nemajerova, A., Kramer, D., Siller, S.S., Herr, C., Shomroni, O., Pena, T., Suazo, C.G., cytonemes in vertebrates. Elife 7, e36953. https://doi.org/10.7554/eLife.36953. Glaser, K., Wildung, M., Steffen, H., Sriraman, A., Oberle, F., Wienken, M., Mattila, P.K., Salminen, M., Yamashiro, T., Lappalainen, P., 2003. Mouse MIM, a tissue- Hennion, M., Vidal, R., Royen, B., Alevra, M., Schild, D., Bals, R., Dönitz, J., specific regulator of cytoskeletal dynamics, interacts with ATP-actin monomers Riedel, D., Bonn, S., Takemaru, K.I., Moll, U.M., Lizé, M., 2016. TAp73 is a central through its C-terminal WH2 domain. J. Biol. Chem. 278, 8452–8459. https://doi. transcriptional regulator of airway multiciliogenesis. Genes Dev. 30, 1300–1312. org/10.1074/jbc.M212113200. https://doi.org/10.1101/gad.279836.116. May-Simera, H., 2016. Evaluation of planar-cell-polarity phenotypes in ciliopathy mouse Nishimura, D.Y., Baye, L.M., Perveen, R., Searby, C.C., Avila-Fernandez, A., Pereiro, I., mutant cochlea. J. Vis. Exp. 53559. https://doi.org/10.3791/53559. Ayuso, C., Valverde, D., Bishop, P.N., Manson, F.D.C., Urquhart, J., Stone, E.M., May-Simera, H.L., Petralia, R.S., Montcouquiol, M., Wang, Y.-X., Szarama, K.B., Liu, Y., Slusarski, D.C., Black, G.C.M., Sheffield, V.C., 2010. Discovery and functional Lin, W., Deans, M.R., Pazour, G.J., Kelley, M.W., 2015. Ciliary proteins Bbs8 and analysis of a retinitis pigmentosa gene, C2ORF71. Am. J. Hum. Genet. 86, 686–695. Ift20 promote planar cell polarity in the cochlea. Development 142, 555–566. https://doi.org/10.1016/j.ajhg.2010.03.005. https://doi.org/10.1242/dev.113696. Nürnberger, J., Kribben, A., Saez, A.O., Heusch, G., Philipp, T., Phillips, C.L., 2004. The May-Simera, H.L., Gumerson, J.D., Gao, C., Campos, M., Cologna, S.M., Beyer, T., Invs gene encodes a microtubule-associated protein. J. Am. Soc. Nephrol. 15, Boldt, K., Kaya, K.D., Patel, N., Kretschmer, F., Kelley, M.W., Petralia, R.S., 1700–1710. https://doi.org/10.1097/01.ASN.0000128291.30249.D0. Davey, M.G., Li, T., 2016. Loss of MACF1 abolishes ciliogenesis and disrupts Obino, D., Farina, F., Malbec, O., Sáez, P.J., Maurin, M., Gaillard, J., Dingli, F., Loew, D., apicobasal polarity establishment in the Retina. Cell Rep. 17, 1399–1413. https:// Gautreau, A., Yuseff, M.I., Blanchoin, L., Théry, M., Lennon-Duménil, A.M., 2016. doi.org/10.1016/j.celrep.2016.09.089. 12 L. Brücker et al. I n t e r n a t i o n a l J o u r n a l o f B i o c h e m i s t r y a n d C e l l B i o l o g y 129 (2020) 105877 Actin nucleation at the centrosome controls lymphocyte polarity. Nat. Commun. 7, ectosome release. J. Cell Biol. 216, 1489–1499. https://doi.org/10.1083/ 10969. https://doi.org/10.1038/ncomms10969. jcb.201608081. Otto, E.A., Schermer, B., Obara, T., O’Toole, J.F., Hiller, K.S., Mueller, A.M., Ruf, R.G., Sarkisian, M.R., Semple-Rowland, S.L., 2019. Emerging roles of primary cilia in glioma. Hoefele, J., Beekmann, F., Landau, D., Foreman, J.W., Goodship, J.A., Strachan, T., Front. Cell. Neurosci. https://doi.org/10.3389/fncel.2019.00055. Kispert, A., Wolf, M.T., Gagnadoux, M.F., Nivet, H., Antignac, C., Walz, G., Schmidt, K.N., Kuhns, S., Neuner, A., Hub, B., Zentgraf, H., Pereira, G., 2012. Cep164 Drummond, I.A., Benzing, T., Hildebrandt, F., 2003. Mutations in INVS encoding mediates vesicular docking to the mother centriole during early steps of ciliogenesis. inversin cause nephronophthisis type 2, linking renal cystic disease to the function of J. Cell Biol. 199, 1083–1101. https://doi.org/10.1083/jcb.201202126. primary cilia and left-right axis determination. Nat. Genet. 34, 413–420. https://doi. Seo, J., Kim, J., 2018. Regulation of Hippo signaling by actin remodeling. BMB Rep. 51, org/10.1038/ng1217. 151–156. https://doi.org/10.5483/BMBRep.2018.51.3.012. Pampliega, O., Orhon, I., Patel, B., Sridhar, S., Díaz-Carretero, A., Beau, I., Codogno, P., Seo, S., Guo, D.F., Bugge, K., Morgan, D.A., Rahmouni, K., Sheffield, V.C., 2009. Satir, B.H., Satir, P., Cuervo, A.M., 2013. Functional interaction between autophagy Requirement of Bardet-Biedl syndrome proteins for leptin receptor signaling. Hum. and ciliogenesis. Nature 502, 194–200. https://doi.org/10.1038/nature12639. Mol. Genet. 18, 1323–1331. https://doi.org/10.1093/hmg/ddp031. Pan, J., You, Y., Huang, T., Brody, S.L., 2007. RhoA-mediated apical actin enrichment is Seo, H.S., Habas, R., Chang, C., Wang, J., 2017. Bimodal regulation of Dishevelled required for ciliogenesis and promoted by Foxj1. J. Cell. Sci. 120, 1868–1876. function by Vangl2 during morphogenesis. Hum. Mol. Genet. 26, 2053–2061. https://doi.org/10.1242/jcs.005306. https://doi.org/10.1093/hmg/ddx095. Park, T.J., Kim, S.K., Wallingford, J.B., 2015. The planar cell polarity effector protein Serezani, C., Kane, S., Medeiros, A., Cornett, A., SH, K., Marques, M., SP, L., Lewis, C., Wdpcp (Fritz) controls epithelial cell cortex dynamics via septins and actomyosin. Bourdonnay, E., Ballinger, M., White, E., Peters-Golden, M., 2012. PTEN activates Biochem. Biophys. Res. Commun. 456, 562–566. https://doi.org/10.1016/j. the actin depolymerization factor Cofilin-1 during PGE2-Mediated inhibition of bbrc.2014.11.078. fungal phagocytosis. Sci. Signal. 5, ra12. https://doi.org/10.1016/j. Patnaik, S.R., Zhang, X., Biswas, L., Akhtar, S., Zhou, X., Kusuluri, D.K., Reilly, J., May- micinf.2011.07.011.Innate. Simera, H., Chalmers, S., McCarron, J.G., Shu, X., 2018. RPGR protein complex Shah, A.S., Yehuda, B.S., Moninger, T.O., Kline, J.N., Welsh, M.J., 2009. Motile cilia of regulates proteasome activity and mediates store-operated calcium entry. human airway epithelia are chemosensory. Science 80 (325), 1131–1134. https:// Oncotarget 9, 23183–23197. https://doi.org/10.18632/oncotarget.25259. doi.org/10.1126/science.1173869. Patnaik, S.R., Kretschmer, V., Brücker, L., Schneider, S., Volz, A.K., Oancea-Castillo, L., Shiba, D., Yamaoka, Y., Hagiwara, H., Takamatsu, T., Hamada, H., Yokoyama, T., 2009. del, R., May-Simera, H.L., 2019. Bardet–Biedl Syndrome proteins regulate cilia Localization of Inv in a distinctive intraciliary compartment requires the C-terminal disassembly during tissue maturation. Cell. Mol. Life Sci. 76, 757–775. https://doi. ninein-homolog-containing region. J. Cell. Sci. 122, 44–54. https://doi.org/ org/10.1007/s00018-018-2966-x. 10.1242/jcs.037408. Patnaik, S.R., Farag, A., Brücker, L., Volz, A.K., Schneider, S., Kretschmer, V., May- Shida, T., Cueva, J.G., Xu, Z., Goodman, M.B., Nachury, M.V., 2010. The major α-tubulin Simera, H.L., 2020. Tissue-dependent differences in Bardet–Biedl syndrome gene K40 acetyltransferase αTAT1 promotes rapid ciliogenesis and efficient expression. Biol. Cell 112, 39–52. https://doi.org/10.1111/boc.201900077. mechanosensation. Proc. Natl. Acad. Sci. U. S. A. 107, 21517–21522. https://doi. Pazour, G.J., San Agustin, J.T., Follit, J.A., Rosenbaum, J.L., Witman, G.B., 2002. org/10.1073/pnas.1013728107. Polycystin-2 localizes to kidney cilia and the ciliary level is elevated in orpk mice Simons, M., Gloy, J., Ganner, A., Bullerkotte, A., Bashkurov, M., Krönig, C., Schermer, B., with polycystic kidney disease. Curr. Biol. 12, 378–380. https://doi.org/10.1016/ Benzing, T., Cabello, O.A., Jenny, A., Mlodzik, M., Polok, B., Driever, W., Obara, T., S0960-9822(02)00877-1. Walz, G., 2005. Inversin, the gene product mutated in nephronophthisis type II, Phua, S.C., Chiba, S., Suzuki, M., Su, E., Roberson, E.C., Pusapati, G.V., Setou, M., functions as a molecular switch between Wnt signaling pathways. Nat. Genet. 37, Rohatgi, R., Reiter, J.F., Ikegami, K., Inoue, T., 2017. Dynamic remodeling of 537–543. https://doi.org/10.1038/ng1552. membrane composition drives cell cycle through primary cilia excision. Cell 168, Slavotinek, A.M., Biesecker, L.G., 2000. Phenotypic overlap of McKusick-Kaufman 264–279. https://doi.org/10.1016/j.cell.2016.12.032 e15. syndrome with Bardet-Biedl syndrome: a literature review. Am. J. Med. Genet. 95, Pitaval, A., Tseng, Q., Bornens, M., Théry, M., 2010. Cell shape and contractility regulate 208–215. https://doi.org/10.1002/1096-8628(20001127)95:3<208::AID- ciliogenesis in cell cycle-arrested cells. J. Cell Biol. 191, 303–312. https://doi.org/ AJMG5>3.0.CO;2-J. 10.1083/jcb.201004003. Song, R., Walentek, P., Sponer, N., Klimke, A., Lee, J.S., Dixon, G., Harland, R., Wan, Y., Pitaval, A., Senger, F., Letort, G., Gidrol, X., Guyon, L., Sillibourne, J., Théry, M., 2017. Lishko, P., Lize, M., Kessel, M., He, L., 2014. MiR-34/449 miRNAs are required for Microtubule stabilization drives 3D centrosome migration to initiate primary motile ciliogenesis by repressing cp110. Nature 510, 115–120. https://doi.org/ ciliogenesis. J. Cell Biol. 216, 3713–3728. https://doi.org/10.1083/jcb.201610039. 10.1038/nature13413. Praveen, K., Davis, E.E., Katsanis, N., 2015. Unique among ciliopathies: Primary ciliary Song, P., Dudinsky, L., Fogerty, J., Gaivin, R., Perkins, B.D., 2016. Arl13b interacts with dyskinesia, a motile cilia disorder. F1000Prime Rep. 7, 36. https://doi.org/ vangl2 to regulate cilia and photoreceptor outer segment length in zebrafish. 10.12703/P7-36. Investig. Ophthalmol. Vis. Sci. 57, 4517–4526. https://doi.org/10.1167/iovs.16- Ran, J., Yang, Y., Li, D., Liu, M., Zhou, J., 2015. Deacetylation of α-tubulin and cortactin 19898. is required for HDAC6 to trigger ciliary disassembly. Sci. Rep. 5, 12917. https://doi. Spencer, W.J., Lewis, T.R., Phan, S., Cady, M.A., Serebrovskaya, E.O., Schneider, N.F., org/10.1038/srep12917. Kim, K.Y., Cameron, L.A., Skiba, N.P., Ellisman, M.H., Arshavsky, V.Y., 2019. Rao, Y., Hao, R., Wang, B., Yao, T.P., 2014. A Mec17-Myosin II effector axis coordinates Photoreceptor disc membranes are formed through an Arp2/3-dependent microtubule acetylation and actin dynamics to control primary cilium biogenesis. lamellipodium-like mechanism. Proc. Natl. Acad. Sci. U. S. A. 116, 27043–27052. PLoS One 9, e114087. https://doi.org/10.1371/journal.pone.0114087. https://doi.org/10.1073/pnas.1913518117. Rao, K.N., Li, L., Zhang, W., Brush, R.S., Rajala, R.V.S., Khanna, H., 2016. Loss of human Srivastava, S., Molinari, E., Raman, S., Sayer, J.A., 2018. Many genes-one disease? disease protein retinitis pigmentosa GTPase regulator (RPGR) differentially affects Genetics of nephronophthisis (NPHP) and NPHP-associated disorders. Front. Pediatr. rod or cone-enriched retina. Hum. Mol. Genet. 25, 1345–1356. https://doi.org/ 5, 287. https://doi.org/10.3389/fped.2017.00287. 10.1093/hmg/ddw017. Stanganello, E., Hagemann, A.I.H., Mattes, B., Sinner, C., Meyen, D., Weber, S., Rbaibi, Y., Cui, S., Mo, D., Carattino, M., Rohatgi, R., Satlin, L.M., Szalinski, C.M., Schug, A., Raz, E., Scholpp, S., 2015. Filopodia-based Wnt transport during Swanhart, L.M., Fölsch, H., Hukriede, N.A., Weisz, O.A., 2012. OCRL1 modulates vertebrate tissue patterning. Nat. Commun. 6, 5846. https://doi.org/10.1038/ cilia length in renal epithelial cells. Traffic 13, 1295–1305. https://doi.org/10.1111/ ncomms6846. j.1600-0854.2012.01387.x. Stokman, M.F., Bijnsdorp, I.V., Schelfhorst, T., Pham, T.V., Piersma, S.R., Knol, J.C., Ríos, H., Paganelli, A.R., Fosser, N.S., 2020. The role of PDLIM1, a PDZ-LIM domain Giles, R.H., Bongers, E.M.H.F., Knoers, N.V.A.M., Lilien, M.R., Jiménez, C.R., protein, at the ribbon synapses in the chicken retina. J. Comp. Neurol. 528, Renkema, K.Y., 2019. Changes in the urinary extracellular vesicle proteome are 1820–1832. https://doi.org/10.1002/cne.24855. associated with nephronophthisis-related ciliopathies. J. Proteomics 192, 27–36. Roepman, R., Wolfrum, U., 2007. Protein networks and complexes in photoreceptor cilia. https://doi.org/10.1016/j.jprot.2018.07.008. Subcell. Biochem. 43, 209–235. https://doi.org/10.1007/978-1-4020-5943-8_10. Streets, A., Prosseda, P., Ong, A., 2020. Polycystin-1 regulates ARHGAP35-dependent Ross, A.J., May-Simera, H., Eichers, E.R., Kai, M., Hill, J., Jagger, D.J., Leitch, C.C., centrosomal RhoA activation and ROCK signalling. JCI Insight. https://doi.org/ Chapple, J.P., Munro, P.M., Fisher, S., Tan, P.L., Phillips, H.M., Leroux, M.R., 10.1172/jci.insight.135385. Henderson, D.J., Murdoch, J.N., Copp, A.J., Eliot, M.-M., Lupski, J.R., Kemp, D.T., Stubbs, J., Oishi, I., Izpisúa Belmonte, J.C., Kintner, C., 2008. The Forkhead protein, Dollfus, H., Tada, M., Katsanis, N., Forge, A., Beales, P.L., 2005. Disruption of Bardet- FoxJ1, specifies node-like cilia in Xenopus and Zebrafish embryos. Nat. Genet. 40, Biedl syndrome ciliary proteins perturbs planar cell polarity in vertebrates. Nat. 1454–1460. https://doi.org/10.1038/ng.267. Genet. 37, 1135–1140. https://doi.org/10.1038/ng1644. Suchy, S.F., Nussbaum, R.L., 2002. The deficiency of PIP2 5-phosphatase in Lowe Rundle, D.R., Gorbsky, G., Tsiokas, L., 2004. PKD2 interacts and co-localizes with mDia1 syndrome affects actin polymerization. Am. J. Hum. Genet. 71, 1420–1427. https:// to mitotic spindles of dividing cells: role of mDia1 in PKD2 localization to mitotic doi.org/10.1086/344517. spindles. J. Biol. Chem. 279, 29728–29739. https://doi.org/10.1074/jbc. Sun, T., Rodriguez, M., Kim, L., 2009. Glycogen synthase kinase 3 in the world of cell M400544200. migration. Dev. Growth Differ. 51, 735–742. https://doi.org/10.1111/j.1440- Sagar, Pröls, F., Wiegreffe, C., Scaal, M., 2015. Communication between distant 169X.2009.01141.x. epithelial cells by filopodia-like protrusions during embryonic development. Takahashi, M., Lin, Y.M., Nakamura, Y., Furukawa, Y., 2004. Isolation and Development 142, 665–671. https://doi.org/10.1242/dev.115964. characterization of a novel gene CLUAP1 whose expression is frequently upregulated Saito, M., Otsu, W., Hsu, K., Chuang, J., Yanagisawa, T., Shieh, V., Kaitsuka, T., Wei, F., in colon cancer. Oncogene 23, 9289–9294. https://doi.org/10.1038/sj. Tomizawa, K., Sung, C., 2017. Tctex-1 controls ciliary resorption by regulating onc.1208100. branched actin polymerization and endocytosis. EMBO Rep. 18, 1460–1472. https:// Tateishi, K., Yamazaki, Y., Nishida, T., Watanabe, S., Kunimoto, K., Ishikawa, H., doi.org/10.15252/embr.201744204. Tsukita, S., 2013. Two appendages homologous between basal bodies and centrioles Salinas, R.Y., Pearring, J.N., Ding, J.D., Spencer, W.J., Hao, Y., Arshavsky, V.Y., 2017. are formed using distinct Odf2 domains. J. Cell Biol. 203, 417–425. https://doi.org/ Photoreceptor discs form through peripherindependent suppression of ciliary 10.1083/jcb.201303071. 13 L. Brücker et al. I n t e r n a t i o n a l J o u r n a l o f B i o c h e m i s t r y a n d C e l l B i o l o g y 129 (2020) 105877 Thurston, S.F., Kulacz, W.A., Shaikh, S., Lee, J.M., Copeland, J.W., 2012. The ability to Werner, M.E., Ward, H.H., Phillips, C.L., Miller, C., Gattone, V.H., Bacallao, R.L., 2013. induce microtubule acetylation is a general feature of formin proteins. PLoS One 7, Inversin modulates the cortical actin network during mitosis. Am. J. Physiol. - Cell e48041. https://doi.org/10.1371/journal.pone.0048041. Physiol. 305, 36–47. https://doi.org/10.1152/ajpcell.00279.2012. Tingler, M., Kurz, S., Maerker, M., Ott, T., Fuhl, F., Schweickert, A., LeBlanc-Straceski, J. Williams, D.S., 1991. Actin filaments and photoreceptor membrane turnover. BioEssays M., Noselli, S., Blum, M., 2018. A conserved role of the unconventional myosin 1d in 13, 171–178. https://doi.org/10.1002/bies.950130405. laterality determination. Curr. Biol. 28, 810–816. https://doi.org/10.1016/j. Williams, D.S., Linberg, K.A., Vaughan, D.K., Fariss, R.N., Fisher, S.K., 1988. Disruption cub.2018.01.075. of microfilament organization and deregulation of disk membrane morphogenesis by Toriyama, M., Lee, C., Taylor, S.P., Duran, I., Cohn, D.H., Bruel, A.L., Tabler, J.M., cytochalasin D in rod and cone photoreceptors. J. Comp. Neurol. 272, 161–176. Drew, K., Kelly, M.R., Kim, S., Park, T.J., Braun, D., Pierquin, G., Biver, A., https://doi.org/10.1002/cne.902720202. Wagner, K., Malfroot, A., Panigrahi, I., Franco, B., Al-lami, H.A., Yeung, Y., Choi, Y. Wong, S.Y., Seol, A.D., So, P.L., Ermilov, A.N., Bichakjian, C.K., Epstein, E.H., Dlugosz, A. J., Duffourd, Y., Faivre, L., Rivière, J.B., Chen, J., Liu, K.J., Marcotte, E.M., A., Reiter, J.F., 2009. Primary cilia can both mediate and suppress Hedgehog Hildebrandt, F., Thauvin-Robinet, C., Krakow, D., Jackson, P.K., Wallingford, J.B., pathway-dependent tumorigenesis. Nat. Med. 15, 1055–1061. https://doi.org/ 2016. The ciliopathy-associated CPLANE proteins direct basal body recruitment of 10.1038/nm.2011. intraflagellar transport machinery. Nat. Genet. 48, 648–656. https://doi.org/ Woo, Y.M., Kim, D.Y., Koo, N.J., Kim, Y.M., Lee, S., Ko, J.Y., Shin, Y., Kim, B.H., Mun, H., 10.1038/ng.3558. Choi, S., Lee, E.J., Shin, J.O., Park, E.Y., Bok, J., Park, J.H., 2017. Profiling of Torres, V.E., Harris, P.C., 2009. Autosomal dominant polycystic kidney disease: the last 3 miRNAs and target genes related to cystogenesis in ADPKD mouse models. Sci. Rep. years. Kidney Int. 76, 149–168. https://doi.org/10.1038/ki.2009.128. 7, 14151. https://doi.org/10.1038/s41598-017-14083-8. Travis, G.H., Sutcliffe, J.G., Bok, D., 1991. The retinal degeneration slow (rds) gene Woodford, B.J., Blanks, J.C., 1989. Localization of actin and tubulin in developing and product is a photoreceptor disc membrane-associated glycoprotein. Neuron 6, adult mammalian photoreceptors. Cell Tissue Res. 256, 495–505. https://doi.org/ 61–70. https://doi.org/10.1016/0896-6273(91)90122-G. 10.1007/BF00225597. Tsang, W.Y., Dynlacht, B.D., 2013. CP110 and its network of partners coordinately Wu, X., Kodama, A., Fuchs, E., 2008. ACF7 regulates cytoskeletal-focal adhesion regulate cilia assembly. Cilia 2, 9. https://doi.org/10.1186/2046-2530-2-9. dynamics and migration and has ATPase activity. Cell 135, 137–148. https://doi. Tsuji, T., Nakamura, R., Katsuno, T., Kishimoto, Y., Suehiro, A., Yamashita, M., org/10.1016/j.cell.2008.07.045. Uozumi, R., Nakamura, T., Tateya, I., Omori, K., 2018. Long-term preservation of Wu, J., Roman, A.C., Carvajal-Gonzalez, J.M., Mlodzik, M., 2013. Wg and Wnt4 provide planar cell polarity in reversed tracheal epithelium. Respir. Res. 19, 22. https://doi. long-range directional input to planar cell polarity orientation in Drosophila. Nat. org/10.1186/s12931-018-0726-y. Cell Biol. 15, 1045–1055. https://doi.org/10.1038/ncb2806. Veland, I.R., Montjean, R., Eley, L., Pedersen, L.B., Schwab, A., Goodship, J., Wu, D., Yu, D., Wang, X., Yu, B., 2016. F-actin rearrangement is regulated by mTORC2/ Kristiansen, K., Pedersen, S.F., Saunier, S., Christensen, S.T., 2013. Inversin/ Akt/Girdin in mouse fertilized eggs. Cell Prolif. 49, 740–750. https://doi.org/ Nephrocystin-2 is required for fibroblast polarity and directional cell migration. 10.1111/cpr.12285. PLoS One 8. https://doi.org/10.1371/journal.pone.0060193. Wu, C.T., Chen, H.Y., Tang, T.K., 2018. Myosin-Va is required for preciliary vesicle Vicinanza, M., Di Campli, A., Polishchuk, E., Santoro, M., Di Tullio, G., Godi, A., transportation to the mother centriole during ciliogenesis. Nat. Cell Biol. 20, Levtchenko, E., De Leo, M.G., Polishchuk, R., Sandoval, L., Marzolo, M.P., De 175–185. https://doi.org/10.1038/s41556-017-0018-7. Matteis, M.A., 2011. OCRL controls trafficking through early endosomes via Yamagishi, A., Masuda, M., Ohki, T., Onishi, H., Mochizuki, N., 2004. A novel actin PtdIns4,5P 2-dependent regulation of endosomal actin. EMBO J. 30, 4970–4985. Bundling/Filopodium-forming domain conserved in insulin receptor tyrosine kinase https://doi.org/10.1038/emboj.2011.354. substrate p53 and missing in metastasis protein. J. Biol. Chem. 279, 14929–14936. Vladar, E.K., Lee, Y.L., Stearns, T., Axelrod, J.D., 2015. Observing planar cell polarity in https://doi.org/10.1074/jbc.M309408200. multiciliated mouse airway epithelial cells. Methods Cell Biol. 127, 37–54. https:// Yamazaki, D., Kurisu, S., Takenawa, T., 2005. Regulation of cancer cell motility through doi.org/10.1016/bs.mcb.2015.01.016. actin reorganization. Cancer Sci. https://doi.org/10.1111/j.1349-7006.2005.00062. Wang, G., Hu, H.Bin, Chang, Y., Huang, Y., Song, Z.Q., Zhou, S.B., Chen, L., Zhang, Y.C., x. Wu, M., Tu, H.Q., Yuan, J.F., Wang, N., Pan, X., Li, A.L., Zhou, T., Zhang, X.M., Yang, W., Garrett, L., Feng, D., Elliott, G., Liu, X., Wang, N., Wong, Y.M., Choi, N.T., He, K., Li, H.Y., 2019. Rab7 regulates primary cilia disassembly through cilia Yang, Y., Gao, B., 2017. Wnt-induced Vangl2 phosphorylation is dose-dependently excision. J. Cell Biol. 218, 4030–4041. https://doi.org/10.1083/jcb.201811136. required for planar cell polarity in mammalian development. Cell Res. 27, Wang, W., Halasz, E., Townes-Anderson, E., 2019. Actin dynamics, regulated by RhoA- 1466–1484. https://doi.org/10.1038/cr.2017.127. LIMK-cofilin signaling, mediates rod photoreceptor axonal retraction after retinal Yang, T.T., Chong, W.M., Wang, W.J., Mazo, G., Tanos, B., Chen, Z., Tran, T.M.N., injury. Investig. Ophthalmol. Vis. Sci. 60, 2274–2285. https://doi.org/10.1167/ Chen, Y.De, Weng, R.R., Huang, C.E., Jane, W.N., Tsou, M.F.B., Liao, J.C., 2018. iovs.18-26077. Super-resolution architecture of mammalian centriole distal appendages reveals Walentek, P., Song, R., He, L., 2014. microRNAs and cilia: An ancient connection. Cell distinct blade and matrix functional components. Nat. Commun. 9, 2023. https:// Cycle 13, 2315–2316. https://doi.org/10.4161/cc.29827. doi.org/10.1038/s41467-018-04469-1. Walentek, P., Quigley, I.K., Sun, D.I., Sajjan, U.K., Kintner, C., Harland, R.M., 2016. Yang, Y., Hao, H., Wu, X., Guo, S., Liu, Y., Ran, J., Li, T., Li, D., Liu, M., Zhou, J., 2019. Ciliary transcription factors and miRNAs precisely regulate Cp110 levels required for Mixed-lineage leukemia protein 2 suppresses ciliary assembly by the modulation of ciliary adhesions and ciliogenesis. Elife 5, e17557. https://doi.org/10.7554/ actin dynamics and vesicle transport. Cell Discov. 5, 33. https://doi.org/10.1038/ eLife.17557. s41421-019-0100-3. Wang, J., Barr, M.M., 2018. Cell–cell communication via ciliary extracellular vesicles: Yao, G., Su, X., Nguyen, V., Roberts, K., Li, X., Takakura, A., Plomann, M., Zhou, J., 2014. clues from model systems. Essays Biochem. 62, 205–213. https://doi.org/10.1042/ Polycystin-1 regulates actin cytoskeleton organization and directional cell migration EBC20170085. through a novel PC1-pacsin 2-N-wasp complex. Hum. Mol. Genet. 23, 2769–2779. Wang, L., Dynlacht, B.D., 2018. The regulation of cilium assembly and disassembly in https://doi.org/10.1093/hmg/ddt672. development and disease. Development 145, 151407. https://doi.org/10.1242/ Yasunaga, T., Hoff, S., Schell, C., Helmstädter, M., Kretz, O., Kuechlin, S., Yakulov, T.A., dev.151407. Engel, C., Müller, B., Bensch, R., Ronneberger, O., Huber, T.B., Lienkamp, S.S., Wang, W., Townes-Anderson, E., 2015. LIM Kinase, a newly identified regulator of Walz, G., 2015. The polarity protein inturned links NPHP4 to daam1 to control the presynaptic remodeling by rod photoreceptors after injury. Investig. Ophthalmol. subapical actin network in multiciliated cells. J. Cell Biol. 211, 963–973. https://doi. Vis. Sci. 56, 7847–7858. https://doi.org/10.1167/iovs.15-17278. org/10.1083/jcb.201502043. Wang, Q., Zheng, W., Wang, Z., Yang, J.W., Hussein, S., Tang, J., Chen, X.Z., 2015. Yeyati, P.L., Schiller, R., Mali, G., Kasioulis, I., Kawamura, A., Adams, I.R., Playfoot, C., Filamin-A increases the stability and plasma membrane expression of polycystin-2. Gilbert, N., van Heyningen, V., Wills, J., von Kriegsheim, A., Finch, A., Sakai, J., PLoS One 10, 1–19. https://doi.org/10.1371/journal.pone.0123018. Schofield, C.J., Jackson, I.J., Mill, P., 2017. KDM3A coordinates actin dynamics with Wang, L., Lee, K., Malonis, R., Sanchez, I., Dynlacht, B.D., 2016. Tethering of an E3 ligase intraflagellar transport to regulate cilia stability. J. Cell Biol. 216, 999–1013. by PCM1 regulates the abundance of centrosomal KIAA0586/Talpid3 and promotes https://doi.org/10.1083/jcb.201607032. ciliogenesis. Elife 5, e12950. https://doi.org/10.7554/eLife.12950. Yoder, B.K., Hou, X., Guay-Woodford, L.M., 2002. The polycystic kidney disease Wang, Y., Naturale, V.F., Adler, P.N., 2017. Planar cell polarity effector fritz interacts proteins, polycystin-1, polycystin-2, polaris, and cystin, are co-localized in renal with dishevelled and has multiple functions in regulating PCP. G3 Genes, Genomes, cilia. J. Am. Soc. Nephrol. 13, 2508–2516. https://doi.org/10.1097/01. Genet. 7, 1323–1337. https://doi.org/10.1534/g3.116.038695. ASN.0000029587.47950.25. Wang, L., Failler, M., Fu, W., Dynlacht, B.D., 2018. A distal centriolar protein network Young, K.G., Thurston, S.F., Copeland, S., Smallwood, C., Copeland, J.W., 2008. INF1 is a controls organelle maturation and asymmetry. Nat. Commun. 9, 3938. https://doi. novel microtubule-associated formin. Mol. Biol. Cell 19, 5168–5180. https://doi. org/10.1038/s41467-018-06286-y. org/10.1091/mbc.E08-05-0469. Waters, A.M., Beales, P.L., 2011. Ciliopathies: an expanding disease spectrum. Pediatr. Zhang, C., Zhang, W., Lu, Y., Yan, Xiaoyi, Yan, Xiumin, Zhu, X., Liu, W., Yang, Y., Nephrol. 26, 1039–1056. https://doi.org/10.1007/s00467-010-1731-7. Zhou, T., 2016. NudC regulates actin dynamics and ciliogenesis by stabilizing cofilin Wei, Q., Zhang, Y., Li, Y., Zhang, Q., Ling, K., Hu, J., 2012. The BBSome controls IFT 1. Cell Res. 26, 239–253. https://doi.org/10.1038/cr.2015.152. assembly and turnaround in cilia. Nat. Cell Biol. 14, 950–957. https://doi.org/ Zhu, P., Xu, X., Lin, X., 2015. Both ciliary and non-ciliary functions of Foxj1a confer Wnt/ 10.1038/ncb2560. β-catenin signaling in zebrafish left-right patterning. Biol. Open 4, 1376–1386. Wei, Q., Gu, Y.F., Zhang, Q.J., Yu, H., Peng, Y., Williams, K.W., Wang, R., Yu, K., Liu, T., https://doi.org/10.1242/bio.012088. Liu, Z.P., 2018. Lztfl1/BBS17 controls energy homeostasis by regulating the leptin Zhu, S., Dai, J., Liu, H., Cong, X., Chen, Y., Wu, Y., Hu, H., Heng, B.C., Ouyang, H.W., signaling in the hypothalamic neurons. J. Mol. Cell Biol. 10, 402–410. https://doi. Zhou, Y., 2015. Down-regulation of rac GTPase-activating protein OCRL1 causes org/10.1093/jmcb/mjy022. aberrant activation of rac1 in osteoarthritis development. Arthritis Rheumatol. 67, 2154–2163. https://doi.org/10.1002/art.39174. 14 Discussion 3. Discussion To understand the molecular mechanisms underlying human ciliopathies such as Bardet-Biedl syndrome (BBS), it is imperative to know both the ciliary and non-ciliary functions of ciliary proteins. Besides their well-described role during ciliogenesis, BBS proteins have been found to affect cilia-related Wnt signalling. Recent data also indicate alternative functions of BBS proteins in intracellular trafficking, cell cycle regulation, proteasomal degradation, DNA damage response, transcriptional regulation, and the actin cytoskeleton. In the context of this thesis, the cilia-dependent and independent functions of BBS proteins were investigated in more detail with a particular focus on their role during Wnt signalling. Thus, Bbs gene levels in different mouse tissues were analysed to identify potential tissue-dependent functions of BBS proteins. Since one of the primary features of Bardet-Biedl syndrome is vision loss, the function of BBS proteins during development of the retinal pigment epithelium (RPE) was investigated in more detail and set in context to cilia related Wnt signalling. And finally, since Wnt signalling affects the downstream actin networks, the regulation of the actin cytoskeleton via BBS proteins was of further interest. The following sections describe and discuss the findings of the presented publications and manuscripts that make up this thesis and the additional data incorporated in section 3.3. 3.1. Investigation of potential tissue-dependent regulations of BBS proteins Bardet-Biedl syndrome is a pleiotropic and variable ciliopathy (Badano et al., 2006; Katsanis, 2004), which can affect various organs and tissues, such as the retina, kidney, genitals, bone or brain (Beales et al., 1999; Florea et al., 2021; Forsythe and Beales, 2013). There is no distinct genotype-to-phenotype correlation, further complicating the diagnosis (Daniels et al., 2012; Deveault et al., 2011). Factors that affect the phenotypic occurrence of BBS are genetic heterogeneity, gene modifiers and the involvement of BBS proteins in various protein networks and signalling pathways that together have diverse symptomatic effects (Florea et al., 2021). On the other hand, mutations in a few select BBS genes can still be associated with a specific phenotype. For example mutations in the genes encoding the three chaperonin-like proteins BBS6, BBS10 and BBS12 often show overlapping phenotypes that are often more severe than mutations in other BBS genes (Billingsley et al., 2010; Castro-Sánchez et al., 2015; Imhoff et al., 2011). Moreover, mutations in BBS6, BBS10 or BBS12 are more often associated with 24 Discussion kidney phenotypes, whereas mutations in the BBSome genes might correlate with hypogonadism (Imhoff et al., 2011; Manara et al., 2019). The BBSome core components BBS2, BBS7 and BBS9 are furthermore often implicated in kidney development and health (Niederlova et al., 2019). Publication I aimed to identify possible correlations between Bbs gene expressions in different mouse tissues and their known protein function in relation to symptomatic features. 3.1.1. Tissue-dependent differences in expression of the BBSome subunits To investigate the potential tissue dependent functions of BBS proteins in more detail, the expression profile of BBSome genes was assessed in different mouse organs including brain, kidney, lung, spleen, heart, oviduct, and retina (Publication I). This analysis revealed that the expression levels of most BBSome components (with the exception of Bbs1 and Bbs18) was significantly upregulated in the retina in comparison to other tissues. Since one of the main features of Bardet-Biedl syndrome is blindness, the high expression of BBSome components suggests a prominent role for these proteins within the retina. Indeed, photoreceptor cells contain a highly specialised primary cilium comprising the connecting cilium between inner and outer segment and the outer segment (May-Simera et al., 2017). The BBSome is required for efficient trafficking across the connecting cilium, highlighting its importance within the retina (Bales et al., 2020; Datta et al., 2015). Since the photoreceptor outer segment is constantly renewed and has a high protein turnover, the role of the BBSome in facilitating cargo trafficking within outer segments is critical. Some BBSome components such as BBS5 or BBS8 have retina-specific isoforms, which might be the consequence of the important role of the BBSome during retinal ciliary transport (Bolch et al., 2016; Riazuddin et al., 2010). In contrast to cilia in other tissues, the BBSome within photoreceptor cells can enter the cilium even when it is not completely assembled; only BBS8 is required for the entry of the (partial assembled) BBSome into photoreceptor cilia, highlighting early on a tissue-specific ciliary function (Dilan et al., 2018; Hsu et al., 2021). Knockout of Bbs8 in mouse tissues led to a significant downregulation of several components of the BBSome, of which the BBSome core component Bbs7 was most strongly affected (Publication I). Particular in the retina, most BBSome components were significantly downregulated upon loss of Bbs8, underlining the importance of Bbs8 in photoreceptor cilia (Dilan et al., 2018; Hsu et al., 2021). Loss of the chaperonin-like protein Bbs6, which is required 25 Discussion for BBSome assembly, did not affect the expression of BBSome components in most tissues remarkably. However, all BBSome components except Bbs2 were notably upregulated in spleen, suggesting that the interaction between Bbs6 and the BBSome in spleen is highly critical for BBSome function. 3.1.2. Tissue-dependent differences in expression of the chaperonin-like Bbs genes In comparison to the BBSome, expression levels of the three chaperonin-like Bbs genes did not vary a lot between different tissues (Publication I). However, it was conspicuous that Bbs12 was slightly more abundant in spleen, oviduct and retina tissues. Although all three chaperonin- like proteins carry several insertions which make them non-functional chaperonins, it is feasible that BBS12 is more similar to CCT chaperonins and thus has a more important function in different tissues (Kim et al., 2005; Mukherjee et al., 2010; Stoetzel et al., 2007, 2006). It is also plausible that it might be required to fold other proteins besides the BBSome in a tissue- dependent mechanism. In regard to the phenotypic occurrence of BBS, mutations of the three chaperonin-like genes are often associated with a kidney phenotype, however an increased expression of these genes in the kidney was not observed (Imhoff et al., 2011; Manara et al., 2019). Loss of Bbs8 also affected the levels of the chaperonin-like genes in different tissues, however the effect was not as significant as for some of the BBSome components. Since the chaperonin- like complex is required for BBSome assembly, the observed changes of Bbs6, Bbs10 or Bbs12 upon loss of Bbs8 might be due to transcriptional feedback regulations. Interestingly, in the oviduct, Bbs12 compensating the reduced expression of Bbs6 due to loss of Bbs8 could be observed, suggesting an important role for Bbs8 in the oviduct. Concordantly, mutations in BBSome components are more often associated with hypogonadism (Imhoff et al., 2011; Manara et al., 2019). Surprisingly, loss of Bbs6 mostly left expression levels of Bbs10 and Bbs12 unaffected. Since BBS6 and BBS12 together recruit BBS7 to enable its folding by the CCT chaperonin complex, it is plausible that Bbs12 can compensate the loss of Bbs6 in most tissues on a functional but not transcriptional level, which might be why an increased expression of Bbs12 upon loss of Bbs6 was not observed (Seo et al., 2010; Zhang et al., 2012). Still, a tissue-dependent function for Bbs6 and the chaperonin-like complex could be suggested as most BBSome components were significantly upregulated in spleen upon loss of Bbs6. However, 26 Discussion there is only one case report of BBS coinciding with splenic lobulations (Doneray and Orbak, 2006). Bbs10 as part of the chaperonin-like complex was also significantly upregulated in spleen. Interestingly, Bbs12 was the only gene not affected by loss of Bbs6 in spleen, indicating a potential chaperonin-independent function of Bbs12 in this tissue. Taken together, a differential expression of BBS genes among various tissues was observed, strongly indicating tissue-specific functions of BBS proteins. Especially for the BBSome genes, a higher variability between tissues was observed than for the chaperonin-like complex. BBSome genes were higher expressed especially in the retina, underlining the important function of the BBSome for photoreceptor ciliary transport. However, the higher prevalence of some BBSome components such as Bbs5 and Bbs18 in oviduct or Bbs1 in spleen, heart and oviduct suggests specific tissue-related functions for these proteins that might be independent of their BBSome function. Regarding the chaperonin-like complex, is could be suggested that especially Bbs12 might exert a non-BBSome-related folding function since it was highly expressed in spleen and not affected by loss of Bbs6 in this tissue. Although mutations in the chaperonin-like Bbs genes are often associated with kidney phenotypes (Imhoff et al., 2011; Manara et al., 2019), a higher expression of these genes in the kidney was not observed. 3.1.3. Conclusion and outlook The analysis of tissue-dependent differences in gene regulation of components of the BBSome and the chaperonin-like complex provides a better understanding of potential genotype-to- phenotype correlations. For example a higher expression of BBSome components in the retina is concomitant with the important function of the BBSome during photoreceptor transport (Bales et al., 2020; Datta et al., 2015). Although kidney symptoms are one of the most commonly occurring features of Bardet-Biedl syndrome, gene levels of the Bbs genes were not strikingly affected in this tissue. However, it has to be taken into account, that only mRNA levels of the Bbs genes were analysed which might be not related to the protein level or function at all. Higher mRNA expression of distinct genes does not necessarily lead to higher protein expression or compensation of its function. Thus, it can be concluded that more factors might be involved in the regulation of protein functions. It has to be considered that splicing occurs after transcription affecting protein level and function, which was not taken into account in Publication I. Splicing factors have been implicated in ciliopathy symptoms such as retinitis pigmentosa (Maxwell et al., 2021) and cilia 27 Discussion proteins were shown to be involved in splicing and transcriptional regulation (Gascue et al., 2012; Yildirim et al., 2021). Further studies show that RNA modifications can impact cilia protein translation and provoke or modify ciliary phenotypes (Haward et al., 2021; Li et al., 2021; Lin et al., 2018). On the other hand, BBS proteins such as BBS6 and BBS7 were also found to be involved in transcriptional regulation (Gascue et al., 2012; Scott et al., 2017), suggesting feedback loops to regulate their protein level and function. RNA sequence analysis followed by mass spectrometry of BBS genes and proteins would be needed to identify the consequence of splicing factors on BBS protein expression and function. Furthermore, no distinct genotype-to-phenotype correlation suggests the involvement of other unknown genes and proteins in the development of human ciliopathies. Mutations in genes that were beforehand thought to be unrelated to cilia might result in ciliopathy symptoms, leading to their identification as ciliary genes. One example might be provided by Manuscript I, which will be discussed below, where a ciliary phenotype was caused by loss of the filopodia regulator Fascin-1, a protein not implicated with ciliopathies beforehand. In case of Bardet-Biedl syndrome, a ciliopathy that has been studied for many years, the most recent BBS proteins were only recently identified, demonstrating the highly dynamic development of this field of research (Morisada et al., 2020; Wormser et al., 2019). BBS patients were often found to carry additional mutations in other ciliopathy genes, explaining overlaps between ciliopathies but also providing the potential for more undiagnosed mutations that were not screened for (Lindstrand et al., 2016; Qi et al., 2017). For the diagnosis of Bardet-Biedl syndrome and a distinct genotype-to- phenotype correlation, a whole-genome sequencing is needed to exclude potential additional mutations in other genes that might affect the phenotype. However, the studies described in Publication I provide a valuable insight in the importance of selected Bbs genes in different tissues. Detailed analysis of protein levels via mass spectrometry or western blotting will help to clarify the correlation between gene and protein levels, whereas histology of isolated tissue will help to understand potential alternative functions of Bbs proteins in distinct tissues. 28 Discussion 3.2. Involvement of ciliary BBS proteins in Wnt signalling Primary cilia are involved in various aspects of tissue development. They are required for the communication between cells as they send out and receive signals. This also involves intracellular signal transduction, resulting in the regulation of several signalling pathways such as Wnt, Sonic hedgehog (Shh), Platelet-derived growth factor (PDGF), Notch, Transforming growth factor β (TGFβ) or mammalian Target of rapamycin (mTOR) (Anvarian et al., 2019; Lai and Jiang, 2020; Lee, 2020; Li et al., 2020). Primary cilia and cilia-related Wnt signalling are especially important for the development of the retinal pigment epithelium (RPE) (May- Simera et al., 2018; Schneider et al., 2021; Sun et al., 2021). The RPE is a monolayer of cells between retina and choroid, tightly attached to the photoreceptor outer segments and crucial for photoreceptor function. To prevent damage by photo-oxidative stress, photoreceptors constantly regenerate disks within the outer segment. The shed disks are then phagocytosed by the adjacent RPE cells (Mazzoni et al., 2014). Dysfunction of the RPE affects photoreceptor health which can consequently result in the development of retinopathies (Caceres and Rodriguez-Boulan, 2020). Thus, the function of primary cilia during RPE development is of further interest to understand the underlying mechanisms of retinal degeneration and vision impairment in ciliopathies. As shown in Publication II, RPE development and maturation is tightly linked to ciliary assembly and disassembly. Number and length of primary cilia increases during early RPE maturation until ciliary disassembly is initiated upon RPE maturation. Concomitantly, loss of the ciliary genes Bbs6 and Bbs8 was shown to disturb RPE maturation and function, terminally resulting in retina degeneration and vision loss in mice (Kretschmer et al., 2019; Schneider et al., 2021). Since loss of the BBS proteins BBS6 and BBS8 in hTERT-RPE1 cells reduced cilia numbers and length in Publication II, these data suggest that BBS6 and BBS8 might be involved in the fine regulation of ciliary disassembly processes. This might be coordinated via two processes that are tightly interconnected and will be discussed in more detail below: 1. disassembly factors such as HDAC6 (histone deacetylase 6), that destabilises ciliary tubulin resulting in cilia disassembly, and 2. regulation of the Wnt signalling pathway (section 1.3.). Briefly, during canonical Wnt signalling, binding of the WNT ligand to the Frizzled-LRP5/6 signalosome leads to the recruitment of DVL, CK1α, GSK3β and Axin, subsequently inhibiting the β-catenin destruction complex (Cong et al., 2004; Cselenyi et al., 2008; Davidson et al., 2005; Krasnow et al., 1995; Piao et al., 2008; Stamos et al., 2014). β-catenin accumulates and enters the nucleus, where it activates the transcription of Wnt target genes (Fig. 4). During 29 Discussion non-canonical Wnt signalling, binding of the WNT ligand results in Inversin recruiting DVL, thus activating signalling cascades that target the downstream actin network (Habas et al., 2001; Liu et al., 2008; Simons et al., 2005). Without inhibition, the β-catenin destruction complex phosphorylates β-catenin, resulting in its proteasome-dependent degradation. 3.2.1. BBS proteins interact with Inversin in regulating Wnt signalling There is already lots of evidence for the involvement of BBS proteins in Wnt signalling. In zebrafish, loss of bbs6 and bbs8 leads to a PCP phenotype which is accompanied by increased canonical Wnt activity (Gerdes et al., 2007; May-Simera et al., 2010). Polarisation of stereocilia hair bundles in the developing cochlea is lost upon loss of Bbs6 and Bbs8, resembling a classical PCP phenotype (May-Simera et al., 2015; Ross et al., 2005). BBS8 was further found to interact with both PCP effector proteins Vangl2 and Inversin (May-Simera et al., 2018, 2015, 2010). Concordantly, BBS6 was also found to interact with Inversin (Publication II). Since Inversin localisation at the primary cilium was reduced upon loss of Bbs6, it is feasible that Bbs6 is needed to recruit Inversin to the primary cilium where it activates the switch from canonical to non-canonical Wnt signalling. Besides Inversin regulating Wnt signalling via recruitment of DVL (Simons et al., 2005), it further interacts with and inhibits Aurora A kinase (AurA) (Mergen et al., 2013). Without inhibition, AurA interacts with HEF1 (human enhancer of filamentation 1), phosphorylating and activating the ciliary disassembly component HDAC6 (Fig. 5) (Pugacheva et al., 2007). Thus, it was suggested that BBS proteins, as a consequence of PCP signalling, stabilise primary cilia via interaction with Inversin, thus inactivating AurA and HDAC6-mediated disassembly. 3.2.2. BBS proteins affect Wnt signalling via regulation of β-catenin levels Additionally, HDAC6 deacetylates and stabilises the Wnt signalling effector β-catenin, resulting in the activation of canonical Wnt signalling (Li et al., 2008). Via interaction with Inversin and subsequent regulation of AuroraA-HDAC6, BBS6 and BBS8 were found to promote non-canonical Wnt signalling via precise regulation of β-catenin phosphorylation and acetylation levels (Publication II). During non-canonical Wnt signalling, β-catenin is first phosphorylated at residue Ser45 by CK1α which initiates its phosphorylation at Ser33, Ser37 at Thr41 by GSK3β (Amit et al., 2002; Ikeda et al., 1998; Liu et al., 2002; Wu and He, 2006). 30 Discussion Phosphorylation of β-catenin then enables its ubiquitin-dependent proteasomal degradation (Hart et al., 1999; Yanagawa et al., 2002; Yost et al., 1996). On the other hand, the role of acetylation of β-catenin at Lys49 via CBP is controversial and seems to be cell-type specific. Several studies suggest that acetylation of β-catenin is required for its transcriptional activation of Wnt target genes and is thus associated with canonical Wnt signalling (Chen et al., 2020; Hoffmeyer et al., 2017; Iaconelli et al., 2015; Liu et al., 2020; Wang et al., 2013; Yang et al., 2008). On the other hand, the acetylation of β-catenin is also suggested to enable its phosphorylation and subsequent proteasomal degradation (Li et al., 2008; Schofield et al., 2013; Wolf et al., 2002). As mentioned above, the acetylation of β-catenin seems to be rather cell- type and promoter specific and is finely coordinated by different acetylases and deacetylases. As shown in Publication II, in hTERT-RPE1 cells, deacetylation of β-catenin via HDAC6 is associated with its active, non-phosphorylated form, thus activating canonical Wnt signalling. Fig. 5: BBS proteins affect ciliogenesis via regulation of Inversin. BBS6 is required to recruit Inversin to the primary cilium where it interacts with and inhibits HEF1. Thus, HEF1 is not able to activate HDAC6 together with AurA, so that HDAC6 cannot induce ciliary disassembly by deacetylation of ciliary tubulin. Without HDAC6 activated, β-catenin is acetylated and phosphorylated, consequently targeted for proteasomal degradation. On the other hand, Inversin activates non-canonical Wnt signalling via interaction with Dishevelled (DVL) at the ciliary base, which results in the activation of downstream signalling cascades, activating the downstream actin network. Since a stable actin network is needed to induce ciliogenesis, this might create a feedback mechanism in stabilising primary cilia. Ac: Acetylation; P: phosphorylation. 31 Discussion In conclusion, a two-way mechanism was identified during which BBS proteins protect primary cilia from disassembly via interaction and recruitment of Inversin. Since this affects post- translational modifications of β-catenin, BBS proteins promote non-canonical Wnt signalling as well, which is in line with previous data (Fig. 5) (Gerdes et al., 2007; May-Simera et al., 2018, 2015, 2010; Ross et al., 2005). However, the mechanism behind this is not completely solved since loss of Inversin generates a cell-type specific ciliary phenotype, not always correlating with reduced cilia numbers and length (Mergen et al., 2013; Veland et al., 2013). The same seems to be true for BBS6 since there are inconsistent data on the ciliation phenotype in Bbs6 deficient kidney medullary cells (Hernandez-Hernandez et al., 2013; Volz et al., 2021). A potential explanation for the complex and tissue-dependent differences observed might be ascribed to the suppression of canonical Wnt signalling. Ciliogenesis is associated with non- canonical Wnt signalling as described above (Balmer et al., 2015; Corbit et al., 2008; Cui et al., 2013; Gerdes et al., 2007; May-Simera et al., 2015, 2010; McMurray et al., 2013; Wang et al., 2017), however conversely, downstream rearrangements of the actin network as a result of non- canonical Wnt could also affect ciliogenesis in complex feedback mechanisms as described in section 1.1.2 and Publication III. Taken together, these data only shed light on a small part of the big picture including ciliogenesis, Wnt signalling, ciliary disassembly components and the actin network (Fig. 5). More insight into the co-regulation between BBS proteins, cilia and actin will be provided in section 3.3. 3.2.3. Conclusion and outlook Publication II provides a detailed analysis of how BBS proteins regulate ciliary Wnt signalling via Inversin and HDAC6 and are involved in ciliary disassembly. The analysis of the pathways underlying ciliopathies provides a starting point for the development of therapeutic approaches that target these pathways. For example, in polycystic kidney disease (PKD), a common phenotype of ciliopathies, therapeutic approaches targeting Wnt and HDAC6-related signalling have demonstrated promising results since PKD1 and PKD2, the responsible genes mutated in polycystic kidney disease, are known Wnt cell-surface receptors. Pharmacological inhibition of HDAC6, affecting both ciliogenesis and Wnt signalling as discussed above, has been shown to reduce the formation of kidney cysts and kidney failure in mouse models of polycystic kidney disease, showing its potential for clinical applications (Li, 2011). Concordantly, direct 32 Discussion inhibition of β-catenin improved renal function and decreased lethality of Pkd mouse models (Li et al., 2018). In relation to ciliogenesis, inhibition of canonical Wnt signalling in iPSC- derived RPE cells restored cilia and maturation of the RPE (May-Simera et al., 2018). Treatment with the Wnt antagonist Dkk1 rescued differentiation of osteoblasts and abnormal cilia formation previously induced by coculture with gastric cancer cells (Xu et al., 2021). Thus, the data of Publication II elucidate the regulations between primary cilia, BBS proteins and Wnt signalling in more detail, providing a basis for understanding the underlying mechanisms and how Wnt inhibitors in therapeutic approaches would affect cell homeostasis on a broader background. However, it has to be taken into account that several pathways might interact in regulating cell homeostasis and ciliogenesis as shown by the example of HDAC6 that regulates deacetylation of both ciliary tubulin and β-catenin. Especially downstream Wnt targets are often regulated via other processes as well, such as Cyclin D1 as a prominent cell cycle target. β-catenin and Inversin are both phosphorylated via Akt, part of the mTOR pathway, showing complicated phosphorylation regulations that might affect each other subsequently (Ponce et al., 2011; Suizu et al., 2016). Furthermore, the acetylation of β-catenin was shown to be highly tissue-dependent (Chen et al., 2020; Li et al., 2008; Liu et al., 2020; Schofield et al., 2013; Wolf et al., 2002), complicating the understanding of these pathways in different tissues. The discussion of the data of Publication II is moreover based on the finding that ciliogenesis is accompanied by inhibited canonical Wnt and increased PCP signalling (Gerdes et al., 2007; May-Simera, 2016; May-Simera et al., 2010; May-Simera and Kelley, 2012; Simons et al., 2005; Volz et al., 2021). Contrary, it was suggested that Wnt signalling in total is not correlating with ciliogenesis at all (Bernatik et al., 2021), supported by data showing that specific Wnt ligands (WNT3a/WNT5a) can induce YAP/TAZ signalling independently of Wnt signalling (Park et al., 2015). However, when analysing these data, it must be considered that PCP signalling in cells does not resemble a tissue phenotype, where the regulation of PCP is even more critical, for example in epithelial polarisation. Taken together, these data again indicate tissue-dependent differences in the regulation of Wnt signalling which might be of further interest for the studies in Publication I, where the analysis of selected Wnt genes in different tissues might be useful. A more detailed analysis of the downstream Wnt phenotypes of different tissues lacking Bbs6 might be of further interest to gain a better understanding of the regulation between Bbs proteins and Wnt. 33 Discussion In conclusion, Publication II provides a valuable insight into how BBS proteins affect ciliary disassembly and Wnt signalling, although the exact cooperation between Wnt and ciliogenesis still needs further investigation. Since Wnt signalling targets the downstream actin cytoskeleton, the interplay between BBS proteins, Wnt and actin will be discussed in the following section. 3.3. Interplay between primary cilia and the actin network Primary cilia are involved in the regulation of several signalling pathways such as Wnt, Sonic hedgehog (Shh) or Platelet-derived growth factor (PDGF) (Anvarian et al., 2019; Bershteyn et al., 2010; Lee, 2020). The regulation of Wnt signalling coordinates various cellular processes including differentiation, proliferation, polarisation and migration. Many of these processes are maintained via changes of the subapical actin network. Especially non-canonical Wnt (PCP) signalling results in actin polymerisation and cell migration because it targets many important actin regulators such as formins and Rho GTPases. Since BBS proteins promote PCP signalling via regulation of Inversin (Publication II), it is feasible that they also affect the downstream actin network. There is already lots of evidence for BBS proteins in regulating actin and actin- related proteins either as a downstream response of PCP signalling or as a possible alternative non-ciliary function of BBS proteins. The Bbs proteins Bbs8 and Bbs9 were found to localise to actin-based focal adhesions, indicating a regulatory role at these sites (Hernandez-Hernandez et al., 2013). Bbs4, Bbs6 and Bbs8 organise the apical actin network and inhibit polymerisation of actin stress fibres via regulation of RhoA signalling (Hernandez-Hernandez et al., 2013; May-Simera et al., 2010). Further data postulate a regulation of filopodia and lamellipodia (Hernandez-Hernandez et al., 2013; Tobin et al., 2008). An even more direct connection between BBS and actin regulators was shown with BBS6, that directly interacts with the microtubule and actin crosslinking factor 1 (MACF1) (May-Simera et al., 2016, 2009). MACF1 connects microtubules to actin filaments to enable formation of cell-cell-contacts and is thus involved in embryonic development, cell migration and proliferation (Cusseddu et al., 2021). Via interaction with BBS6, MACF1 is required for ciliogenesis since it promotes the transport and docking of ciliary vesicles to the mother centriole (May-Simera et al., 2016). It further maintains the anchoring of microtubules at the basal body, thus enabling transport of ciliary proteins to the cilium. On the other hand, MACF1 34 Discussion positively regulates the phosphorylation of GSK3β, which is why it might be involved in the downstream Wnt response as well (Lin et al., 2019). These data already indicate an alternative mechanism especially for BBS proteins in affecting downstream actin structures. However, the underlying mechanisms between cilia and actin are still not fully understood. 3.3.1. The ciliary protein Bbs6 regulates filopodia length To investigate the interplay between BBS proteins and actin in more detail, the first aim of Manuscript I was to identify a possible filopodia phenotype upon loss of Bbs proteins. Filopodia are actin-based microspikes that are formed within lamellipodia to seek out and sense the surrounding environment of the cell and are thus part of efficient cell migration (Amarachintha et al., 2015). Loss of the chaperonin-like protein Bbs6 in MEFs reduced filopodia length significantly, indicating a defect in cell sensing. Interestingly, loss of the BBSome component Bbs8 did not result in a filopodia phenotype, although previous data indicated bbs8 being involved in the development of filopodia in zebrafish (Tobin et al., 2008). However, a detailed analysis as performed in Manuscript I was lacking beforehand. Bbs6 and Bbs8 were both found to affect actin structures via regulation of RhoA signalling (Hernandez- Hernandez et al., 2013), however their effect on filopodia seems to be contrary, indicating an alternative function of Bbs6 in filopodia regulations. Bbs6 was now identified to interact with the filopodia regulator Fascin-1, suggesting a more direct regulation of Bbs6 on filopodia (Manuscript I). Fascin-1 is the canonical filopodia regulator since it parallelises and bundles polarised actin filaments, enabling transport of actin- based motor proteins (Pfisterer et al., 2020; Scholz et al., 2020). The structure of Fascin-1 consists of four β-trefoil domains containing two actin-binding domains N- and C-terminal within its phosphorylation sites S39 and S274 (Fig. 6 A; Hashimoto et al., 2007; Zanet et al., 2012). Since the expression level of Fascin-1 remained unchanged in Bbs6 depleted cells, it is plausible that loss of Bbs6 affects the actin binding capacities of Fascin-1. In support of this, BBS6 is a known assistant of CCT chaperonins. Subunits of the CCT complex localise to actin- rich structures in the cell consequently affecting actin polymerisation, and CCT chaperonins were previously found to maintain the folding of cytoskeletal proteins such as actin (Brackley and Grantham, 2010; Dunn et al., 2001; Svanström and Grantham, 2016). Thus, these data provide a basis for suggesting that BBS6 is required for the CCT-dependent folding of actin 35 Discussion regulators such as Fascin-1. Taken together, these data show that BBS6 might regulate filopodia independently of the downstream PCP response via direct interaction with Fascin-1. 3.3.2. Regulation of Fascin-1 in ciliogenesis On the other hand, actin proteins are required for primary cilia development as well. Especially during early ciliogenesis, a stable actin network is needed to enable transport of preciliary vesicles to the basal body and for centrosome positioning and docking at the membrane (Dawe et al., 2009; Hong et al., 2015; Pan et al., 2007; Wu et al., 2018). The basal body is further referred to as an actin-organising centre since actin filaments are nucleated here and connected to focal adhesion complexes and the apical actin network (Antoniades et al., 2014; Farina et al., 2016; Pan et al., 2007). As part of this thesis, a ciliogenesis phenotype was identified in Fascin-1 depleted cells, with reduced cilia numbers, although the length of primary cilia was not altered (Manuscript I). These data suggest that Fascin-1 is involved in early ciliogenesis potentially by providing a stable actin network upon which ciliary vesicles are transported (Hong et al., 2015; May-Simera et al., 2016; Wu et al., 2018). Supporting these data, Fascin-1 was further found to interact with the actin scaffold Nesprin-2 (Fan et al., 2020; Jayo et al., 2016), which activates the RhoA- dependent actin network at the basal body during centrosome positioning (Dawe et al., 2009; Pan et al., 2007). Thus, it is feasible that without Fascin-1, BBS6 cannot be transported to the basal body where it is needed to maintain its chaperonin-like function and to assist Inversin in promoting PCP signalling, which is why ciliogenesis is not induced in the absence of Fascin-1. However, it is still not clear if Fascin-1 is required for BBS6 function or vice versa. Fascin-1 was further found to localise to primary cilia independently of its capacity to bind to microtubules (Manuscript I), suggesting that its localisation is possibly required to structure the axonemal actin filaments (Kiesel et al., 2020). Additional data analysing the localisation of both BBS6 and Fascin-1 in Fig. 6 (below) revealed that the proteins do not completely colocalise at primary cilia, since BBS6 is predominantly found at the basal body while Fascin- 1 seems to be recruited into the axoneme (Fig. 6 B, C). The function of F-actin and actin regulators inside primary cilia is mainly thought to include ectocytosis of ciliary vesicles as a way to disassemble primary cilia (Corral-serrano et al., 2020; Nager et al., 2017; Phua et al., 2017; Spencer et al., 2019; Wang et al., 2019). However, the present data showing that loss of Fascin-1 affects cilia numbers and not cilia length does not indicate a disassembly phenotype 36 Discussion but rather failed induction of ciliogenesis as discussed above. Since many actin regulators were shown to be involved in early ciliogenesis (section 1.1.2. and Publication III), it is conceivable that Fascin-1 is rather involved in preciliary vesicle targeting instead of ciliary disassembly. In support of this, it was suggested that axonemal F-actin is required to stabilise primary cilia (Kiesel et al., 2020); thus a potential explanation for Fascin-1 inside cilia might be that it stabilises axonemal F-actin independently of its function in early ciliogenesis. Fig. 6: Fascin-1 and BBS6 do not completely colocalise at primary cilia. A Fascin-1 consists of four β-trefoil domains containing the two actin-binding sites located at phosphorylation sites S39 and S274. Adapted from Villari et al., 2015. B Overexpression of mRFP-tagged Fascin-1 in ciliated MEFs revealed a distinct localisation inside the ciliary axoneme (upper row) which is concomitant with the data from Manuscript I. EGFP-tagged BBS6 is predominantly found at and around the basal body (upper and lower row). Overexpression of both proteins for 48 hours prior fixation with 4% PFA, serum-starvation for 24 hours. Co-staining with Arl13b as a marker for the ciliary membrane. Scale bars: 10µm, magnified images: 1µm. C Schematic representation of the ciliary localisation of Fascin-1 inside the axoneme and BBS6 at/around the basal body. F-actin filaments were previously identified both at the basal body and inside the axoneme. 3.3.3. Fascin-1 regulates cilia-related PCP signalling Fascin-1 was also found to interact with Inversin, suggesting that it also exerts a regulatory function in PCP signalling (Manuscript I). As discussed in Manuscript I, previous data show a potential regulation of Fascin-1 in Wnt signalling; however, the available data mostly concentrate on cancer cell lines, where the expression of Fascin-1 and Wnt signalling is severely altered (Jayo and Parsons, 2010; Shang et al., 2017). In the present study in MEFs, a non- cancerous cell model, loss of Fascin-1 increased nuclear Cyclin D1 as well as its mRNA 37 Discussion expression, indicating an upregulation of canonical Wnt signalling (Manuscript I). It was previously shown that nuclear Cyclin D1 is associated with enhanced canonical Wnt signalling in Bbs6 depleted kidney medullary cells (Volz et al., 2021), a result that could be recapitulated in this study. Concomitantly, loss of Inversin was previously shown to significantly enhance the transcription of Cyclin D1 (Veland et al., 2013). However, it has to be noted that Cyclin D1 is also a prominent cell cycle protein and could be regulated by different pathways that lead to changes in cell cycle and subsequent regulation of Cyclin D1 (Hirayama et al., 2020; O’Connor et al., 2021). In melanoblasts, Fascin-1 was shown to regulate cell cycle progression and proliferation concomitant with changes in Cyclin D1 expression (Ma et al., 2013). Thus, it might be conceivable that changes in cell cycle rather than Wnt signalling lead to an upregulation of nuclear Cyclin D1. To exclude this fact, acetylated β-catenin was analysed as another Wnt signalling target. As discussed in section 3.2., the acetylation of β-catenin is regulated in a cell-type and promoter specific fashion. In hTERT-RPE1 cells, acetylation of β-catenin is concomitant with activation of PCP signalling (Publication II). However, it seems that in MEFs, acetylation is associated with enhanced canonical Wnt signalling since loss of Bbs6, a well-characterised PCP protein as discussed before, increased nuclear levels of acetylated β-catenin significantly (Manuscript I). Loss of Fascin-1 also enhanced nuclear levels of acetylated β-catenin, supporting the suggestion that Fascin-1 is involved in the regulation of PCP signalling. 3.3.4. Downstream regulation of PCP signalling on actin networks PCP signalling targets many downstream processes including actin and actin-related networks which regulate cell proliferation, division and migration. Especially the regulation of Inversin in cortical actin rearrangements was previously shown and needs to be discussed to explain the downstream effect of PCP signalling (Veland et al., 2013; Werner et al., 2013). In a detailed analysis of the actin phenotype in Inversin depleted MEFs, a disorganisation of focal adhesion proteins concomitant with inhibited cell migration was previously observed (Veland et al., 2013). Targeting of the Rho GTPases Rac1 and RhoA, essential regulators of cell motility, to the leading edges was found to be defective, accompanied by a significant downregulation in the expression of ARP2/3 and WAVE complexes which are required for actin polymerisation. The regulation of Rho GTPases by Inversin was further shown to influence the protein level and localisation of ezrin/radixin/moesin (ERM) and the Na+/H+ exchanger 1 (NHE1) at the 38 Discussion leading edges (Veland et al., 2013). In a separate study, loss of Inversin results in extensive filopodia formation during mitosis and disturbed localisation of focal adhesion proteins such as paxillin (Werner et al., 2013). These changes in the subapical actin networks could be ascribed to changes in PCP signalling shown by transcriptional upregulation of canonical Wnt targets and downregulation of PCP genes such as Gsk3β, Apc and Dvl in the absence of Inversin. In testis cells, Inversin is localised to tight junctions where it regulates tight junction proteins such as ZO-1, N-cadherin and β-catenin (Li et al., 2022). Loss of Inversin in testis cells also affected several actin regulators such as Arp3, vimentin and the capping protein Epidermal growth factor receptor kinase substrate 8 (Eps8), concomitant with the earlier studies of Veland and colleagues. Taken together, there is a lot of overlap in the regulation of actin networks between Inversin and Bbs6 such as RhoA signalling, which can be ascribed to their cooperation in PCP signalling. Since both proteins further interact with the canonical filopodia regulator Fascin-1, additional analysis (not included in Manuscript I) was performed to investigate the overlap in a filopodia phenotype upon loss of Inversin. Analysis of filopodia length in Inversin depleted MEFs via live cell imaging revealed that loss of Inversin significantly increased filopodia length (Fig. 7 A, B). Visualisation of Fascin-1 in fixed MEFs showed that filopodia structures in Inversin depleted cells were completely disrupted (Fig. 7 C), an observation that was not detected in living cells. Since filopodia are highly dynamic structures prone to collapse upon fixation, these data suggest that Inversin promotes the stability of filopodia. Since these data are contrary to Bbs6 depleted MEFs, where filopodia length is reduced, they suggest that Bbs6 and Inversin do not necessarily cooperate in regulating filopodia via Fascin-1 and that the downstream regulations are more complex. Further analysis is needed to investigate alternative regulatory mechanisms that explain the differences in filopodia phenotype between Bbs6 and Inversin in relation to Fascin-1. 39 Discussion Fig. 7: Loss of Inversin affects filopodia. A MEFs were cotransfected with Lifeact as a marker for the actin cytoskeleton (red) and Fascin-1 as a canonical filopodia marker (green). 48 hours after transfection, cells were imaged every five seconds for 30 timepoints on a Nikon Laser Scanning Confocal microscope and the resulting videos were analysed via FiloQuant (Jacquemet et al., 2019) to determine filopodia length. One timepoint shown here as representative image. B Average filopodia length of wildtype (Inv+/+) and Inversin depleted (Inv-/-) MEFs determined via FiloQuant shows significantly longer filopodia upon loss of Inversin. Mann-Whitney-U test: p≤0.01. Experiments were repeated three independent times. NInv+/+=30, NInv-/-=21. C Endogenous localisation of Fascin-1 in wildtype and Inversin depleted cells shows disrupted filopodia structures upon loss of Inversin. A detailed description of the methods can be found in Manuscript I. Taken together, it could be shown that Bbs6 and Inversin regulate filopodia potentially via interaction with the filopodia regulator Fascin-1, however the molecular mechanisms underlying this phenotype are not completely solved. On the other hand, Fascin-1 localises to primary cilia, potentially stabilising axonemal actin. Loss of Fascin-1 is accompanied by a ciliary phenotype, that might be resulting from defective targeting of preciliary vesicles during early ciliogenesis (Fig. 8). Loss of primary cilia subsequently leads to activation of canonical 40 Discussion Wnt signalling. Wnt signalling affects the downstream actin network, which might also regulate ciliogenesis again as a complex feedback mechanism. These data indicate a potential two-way mechanism for Fascin-1 in regulating actin dynamics at filopodia and primary cilia, but show that the interconnecting pathways between cilia and actin are highly complex and are still not fully understood. Fig. 8: Possible mechanisms for Fascin-1 in ciliary regulations. Fascin-1 promotes actin-based development of primary cilia and interacts with BBS6 and Inversin in the regulation of downstream PCP signalling, resulting in changes of filopodia. Changes of the downstream actin network further influence actin-dependent transport of ciliary vesicles to the basal body, affecting ciliogenesis again. 3.3.5. Conclusion and outlook Since Wnt signalling targets the downstream actin networks, Manuscript I aimed to clarify the interplay between Bbs proteins and the actin phenotype. The acquired data will help to understand the downstream regulation of primary cilia on cell homeostasis, thus expanding the knowledge on the molecular background of ciliopathies. Although the existing data on actin phenotypes in ciliary mutant models were expanded by showing specific defects in filopodia length upon loss of Bbs6, the underlying pathways are still not fully understood. The filopodia phenotypes between Bbs6, Bbs8 and Inversin depleted cells are not concordant, although all 41 Discussion proteins were found to regulate PCP signalling cooperatively and Bbs6 and Inversin interact with the filopodia regulator Fascin-1. It is still unknown where the interaction between the proteins takes place: at the cilium or at filopodia, or at both places. Additional data in Fig. 6 of this thesis suggest that BBS6 and Fascin-1 might not interact at the cilium since they do not colocalise. However, a localisation of overexpressed BBS6 at filopodia was not observed and lack of robust endogenous antibodies complicates a visualisation of BBS6 at subciliary locations. Since BBS6 is required for ciliogenesis due to its chaperonin-like function, further studies should investigate if the basal body localisation of BBS6 is changed upon loss of Fascin-1. These data would help to understand if Fascin-1 is needed to facilitate the transport of BBS6 to the basal body as speculated in Fig. 8. On the other hand, CCT chaperonins are known folding proteins for cytoskeletal proteins such as actin, raising the possibility that BBS6 facilitates the folding of Fascin-1 via CCT chaperonins (Brackley and Grantham, 2010; Dunn et al., 2001; Svanström and Grantham, 2016). To clarify if Bbs6 is required for folding of Fascin-1 in cooperation with CCT chaperonins, the interaction between BBS10, BBS12, the CCT complex and Fascin-1 will need further investigation. BBS6 was previously identified to be transported into the nucleus where it affects chromatin remodelling proteins (Scott et al., 2017). Since Fascin-1 was found to interact with Nesprin-2, part of the nuclear lamina connecting the actin cytoskeleton and nuclear membrane, in regulating nuclear shape and movement (Jayo et al., 2016), it is plausible that BBS6 and Fascin-1 might interact at the nuclear envelope. Interestingly, the nuclear lamina proteins Nesprin-2 and lamin A/C were also found to impact ciliogenesis via regulation of actin networks, and Nesprin-2 interacts with the ciliopathy protein Meckelin (Dawe et al., 2009; Fan et al., 2020). In this regard, it would be of further interest to analyse potential interactions between BBS6 and Nesprin-2 or other regulators at the nuclear lamina to expand the understanding on this possible alternative nuclear function of BBS6. Furthermore, BBS6 was previously identified to interact with MACF1 (May-Simera et al., 2016, 2009), which, like Fascin-1, is capable in regulating both microtubules and actin filaments and which was found to impact filopodia formation as well (Sanchez-Soriano et al., 2009). Since MACF1 was shown to regulate early ciliogenesis via anchoring of microtubules to the mother centriole, the role of Fascin-1 during early ciliogenesis should be investigated. Furthermore, the possible regulation of other microtubule and actin regulators in relation to 42 Discussion BBS could be analysed, such as the formin FHDC1 which was found to localise to the basal body where it interacts with subdistal appendage proteins (Copeland et al., 2018). Last, the function of Fascin-1 during Wnt signalling needs further evaluation to gain a better understanding of the complex interplay between ciliogenesis, Wnt and actin networks. Besides Cyclin D1 and acetylated β-catenin, more targets need to be analysed in terms of their localisation and protein expression to better understand how exactly Fascin-1 impacts Wnt in non-cancerous cells. Taken together, Manuscript I provides a valuable insight into how ciliary proteins interact with actin regulators and how these interconnections affect ciliogenesis on one side and actin structures on the other. 43 Final Conclusion & Remarks 4. Final conclusion and remarks In this thesis, the ciliary and non-ciliary functions of BBS proteins were investigated in more detail to provide a better understanding of the molecular mechanisms underlying the development of human ciliopathies such as Bardet-Biedl syndrome. First, the expression of Bbs genes in different mouse tissues was investigated to identify potential tissue-dependent functions of these proteins. In Publication II, the functions of respective BBS proteins were investigated in relation to ciliary disassembly and Wnt signalling during RPE development. Lastly, the downstream function of BBS proteins on actin networks was analysed which provided further data on the ciliary function of actin regulators. As discussed above, these data shed light on the ciliary and non-ciliary functions and underlying pathways regulated by BBS proteins. In conclusion, the acquired data expands our knowledge of the molecular pathways underlying the development of human ciliopathies. They further emphasise the importance of actin and actin-related proteins in ciliogenesis that should be considered in future studies. These data provide insights that can potentially be applied to the development of therapeutics targeting these pathways. Since BBS as the flagship ciliopathy resembles many features of other ciliopathies, the data of this thesis will help to understand other cilia-related diseases as well. 44 Summary 5. Summary Primary cilia are microtubule-based cell organelles that are required for the communication between cells in a tissue and the regulation of intracellular signalling pathways. They are important for tissue development and homeostasis, which is why defects in primary cilia are often associated with genetic disorders, collectively termed ciliopathies. Bardet-Biedl syndrome (BBS) as a flagship ciliopathy combines many clinical features such as retinopathies, kidney disease, obesity and polydactyly. Responsible for the occurrence of BBS are mutations in BBS genes, encoding proteins that are required for primary cilia development, maintenance and function. Although the ciliary function of BBS proteins has been largely discussed, recent research also suggests non-ciliary functions of BBS proteins, indicating more complex mechanisms being involved in the development of human ciliopathies. The knowledge of these complex processes is inevitable to understand ciliopathies in a broader context, enabling a better diagnosis and the potential for development of therapeutics that target these pathways. In the current thesis, the ciliary and non-ciliary functions of BBS proteins were investigated in more detail, demonstrating complex tissue-dependent mechanisms that shed light on the signalling networks of BBS proteins on a cellular level. Publication I suggested that the function of BBS proteins could possibly be tissue-dependent, indicating previously unidentified regulations in specific tissues that need to be examined in more detail. While analysing the cilia- related function of BBS proteins more closely in Publication II, the BBS proteins BBS6 and BBS8 were found to cooperate with the Wnt signalling protein Inversin in regulating Wnt signalling and ciliary disassembly pathways. These data shed light on how BBS proteins regulate ciliogenesis in addition to their classical defined ciliary function and elucidate their role in Wnt signalling. Since Wnt signalling affects the downstream actin network, the implication on important actin-based structures such as filopodia was investigated in more detail in Manuscript I. These data showed that BBS6 affects filopodia via interaction with the actin regulator Fascin-1. Contrary, Fascin-1 localises to primary cilia and its loss provoked a ciliary phenotype, indicating a feedback regulation of Fascin-1 and actin in ciliogenesis. The ciliary phenotype further led to alterations of Wnt signalling, enlightening how actin proteins affect ciliogenesis and cilia-related signalling. In summary, this thesis demonstrates how ciliary BBS proteins affect ciliogenesis and cilia- related Wnt signalling potentially in a tissue-dependent manner and provide a better understanding in how cilia, Wnt and actin regulators affect each other in complex feedback 45 Summary mechanisms. These data provide a basis for studying cilia-related and unrelated functions of BBS proteins in the context of different tissues. They further emphasise the tight connection between ciliogenesis and actin proteins that should be considered in future studies to understand the complex molecular background of human ciliopathies. 6. German summary Primärzilien sind Mikrotubuli-basierte Zellorganelle, die für die interzelluläre Kommunikation in Geweben und die Regulation von intrazellulären Signalwegen wichtig sind. Daher sind Primärzilien insbesondere für die Entwicklung und Homöostase von Organen bedeutsam, weshalb Defekte in ihrem Aufbau und ihrer Funktion oftmals mit genetischen Erkrankungen, den Ziliopathien, einhergehen. Das Bardet-Biedl-Syndrom (BBS) vereinigt viele der symptomalen Erscheinungen von Ziliopathien, wie beispielsweise Retinopathien, Nierenerkrankungen, Adipositas und Polydaktylie, weshalb die Forschung an BBS auch Rückschlüsse auf andere Ziliopathien zulässt. Verantwortlich für das Auftreten von BBS sind Mutationen in den BBS-Genen, welche Proteine kodieren, die für Aufbau, Instandhaltung und Funktion des Primärziliums verantwortlich sind. Die ziliären Funktionen von BBS-Proteinen sind seit langem Bestandteil der Forschung, jedoch weisen neuere Daten auch auf alternative Funktionen in der Zelle hin, die möglicherweise nicht mit dem Zilium in Verbindung stehen. Das genaue Verständnis der ziliären und nicht-ziliären Funktionen von BBS-Proteinen ist daher unabdingbar, um das Gesamtbild von Ziliopathien besser verstehen zu können, die Diagnose zu erleichtern und Behandlungsmöglichkeiten zu entwickeln. In der vorliegenden Arbeit wurden die ziliären und nicht-ziliären Funktionen von BBS- Proteinen genauer beleuchtet, wobei neue komplexe Mechanismen und Signalwege identifiziert wurden, in denen BBS-Proteine involviert sind. Publikation I konzentrierte sich dabei auf die Untersuchung von möglichen Gewebe-abhängigen Mechanismen, was auf potenzielle, bislang nicht identifizierte Regulationen von BBS-Proteinen in unterschiedlichen Organen hinweist. In Publikation II wurde die Zilien-abhängige Funktion der BBS-Proteine näher untersucht, wobei die Regulation der BBS-Proteine BBS6 und BBS8 im Wnt-Signalweg im Zusammenhang mit ihrer Interaktion mit dem Wnt-Regulator Inversin identifiziert wurde. Diese Daten erläutern, wie BBS-Proteine die Ziliogenese alternativ zu ihrer bisher bekannten ziliären Funktion regeln 46 Summary können und schlüsseln ihre Rolle im Wnt-Signalweg genauer auf. Da der Wnt-Signalweg nachgeschaltete Aktin-Netzwerke reguliert, wurde in Manuskript I die Auswirkung der BBS- Proteine auf Aktin-basierte Zellstrukturen wie Filopodien näher untersucht. Dabei wurde gezeigt, dass BBS6 Filopodien mittels Interaktion mit dem Aktin-Regulator Fascin-1 reguliert. Fascin-1 lokalisiert an Primärzilien und seine Abwesenheit bedingt einen ziliären Phänotypen, was ebenfalls den nachgeschalteten Wnt-Signalweg verändert. Diese Daten lassen auf Feedback-Mechanismen schließen, mit denen Fascin-1 und Aktin die Ziliogenese und ziliäre Signalwege steuern können. Zusammenfassend konnte im Rahmen der vorliegenden Thesis gezeigt werden, wie BBS- Proteine die Ziliogenese und den ziliären Wnt-Signalweg in Gewebe-abhängigen Mechanismen steuern. Diese Arbeit bedingt dabei ein besseres Verständnis der komplexen Mechanismen, in denen Primärzilien, der Wnt-Signalweg und Aktin-Regulatoren sich gegenseitig beeinflussen. Dabei schafft diese Arbeit die Basis für weitere Studien, die die genaue Funktion der BBS- Proteine insbesondere in unterschiedlichen Organen näher beleuchtet. Weiterhin wird die enge Beziehung zwischen Aktin-Regulatoren und dem Primärzilium herausgestellt, welche in zukünftigen Studien berücksichtigt werden sollte, um die komplexen Hintergründe in der Entstehung von Ziliopathien besser zu verstehen. 47 References 7. References Ajima, R., Hamada, H., 2011. Wnt signalling escapes to cilia. Nat. Cell Biol. 13, 636–637. Álvarez-Satta, M., Castro-Sánchez, S., Valverde, D., 2017. Bardet-Biedl Syndrome as a Chaperonopathy: Dissecting the Major Role of Chaperonin-Like BBS Proteins (BBS6- BBS10-BBS12). Front. Mol. Biosci. 4, 55. Amarachintha, S.P., Ryan, K.J., Cayer, M., Boudreau, N.S., Johnson, N.M., Heckman, C.A., 2015. Effect of Cdc42 domains on filopodia sensing, cell orientation, and haptotaxis. Cell. Signal. 27, 683–693. Amit, S., Hatzubai, A., Birman, Y., Andersen, J.S., Ben-Shushan, E., Mann, M., Ben-Neriah, Y., Alkalay, I., 2002. Axin-mediated CKI phosphorylation of β-catenin at Ser 45: A molecular switch for the Wnt pathway. Genes Dev. 16, 1066–1076. Antoniades, I., Stylianou, P., Skourides, P.A., 2014. Making the Connection: Ciliary Adhesion Complexes Anchor Basal Bodies to the Actin Cytoskeleton. Dev. Cell 28, 70–80. Anvarian, Z., Mykytyn, K., Mukhopadhyay, S., Pedersen, L.B., Christensen, S.T., 2019. Cellular signalling by primary cilia in development, organ function and disease. Nat. Rev. Nephrol. Badano, J.L., Leitch, C.C., Ansley, S.J., May-Simera, H., Lawson, S., Lewis, R.A., Beales, P.L., Dietz, H.C., Fisher, S., Katsanis, N., 2006. Dissection of epistasis in oligogenic Bardet-Biedl syndrome. Nature 439, 326–330. Bales, K.L., Bentley, M.R., Croyle, M.J., Kesterson, R.A., Yoder, B.K., Gross, A.K., 2020. BBSome component BBS5 is required for cone photoreceptor protein trafficking and outer segment maintenance. Investig. Ophthalmol. Vis. Sci. 61. Balmer, S., Dussert, A., Collu, G.M., Benitez, E., Iomini, C., Mlodzik, M., 2015. Components of Intraflagellar Transport Complex A Function Independently of the Cilium to Regulate Canonical Wnt Signaling in Drosophila. Dev. Cell 34, 705–718. Bangs, F., Anderson, K. V., 2017. Primary cilia and Mammalian Hedgehog signaling. Cold Spring Harb. Perspect. Biol. 9. 48 References Beales, P.L., Elcioglu, N., Woolf, A.S., Parker, D., Flinter, F.A., 1999. New criteria for improved diagnosis of Bardet-Biedl syndrome: Results of a population survey. J. Med. Genet. 36, 437–446. Behrens, J., Von Kries, J.P., Kühl, M., Bruhn, L., Wedlich, D., Grosschedl, R., Birchmeier, W., 1996. Functional interaction of β-catenin with the transcription factor LEF- 1. Nature 382, 638–642. Bernatik, O., Paclikova, P., Kotrbova, A., Bryja, V., Cajanek, L., 2021. Primary Cilia Formation Does Not Rely on WNT/β-Catenin Signaling. Front. Cell Dev. Biol. 9. Bershteyn, M., Atwood, S.X., Woo, W.M., Li, M., Oro, A.E., 2010. MIM and cortactin antagonism regulates ciliogenesis and hedgehog signaling. Dev. Cell 19, 270–283. Bilić, J., Huang, Y.L., Davidson, G., Zimmermann, T., Cruciat, C.M., Bienz, M., Niehrs, C., 2007. Wnt induces LRP6 signalosomes and promotes dishevelled-dependent LRP6 phosphorylation. Science (80-. ). 316, 1619–1622. Billingsley, G., Bin, J., Fieggen, K.J., Duncan, J.L., Gerth, C., Ogata, K., Wodak, S.S., Traboulsi, E.I., Fishman, G.A., Paterson, A., Chitayat, D., Knueppel, T., Millan, J.M., Mitchell, G.A., Deveault, C., Heon, E., 2010. Mutations in chaperonin-like BBS genes are a major contributor to disease development in a multiethnic Bardet-Biedl syndrome patient population. J. Med. Genet. 47, 453–463. Blacque, O.E., Reardon, M.J., Li, C., McCarthy, J., Mahjoub, M.R., Ansley, S.J., Badano, J.L., Mah, A.K., Beales, P.L., Davidson, W.S., Johnsen, R.C., Audeh, M., Plasterk, R.H.A., Baillie, D.L., Katsanis, N., Quarmby, L.M., Wicks, S.R., Leroux, M.R., 2004. Loss of C. elegans BBS-7 and BBS-8 protein function results in cilia defects and compromised intraflagellar transport. Genes Dev. 18, 1630–1642. Bolch, S.N., Dugger, D.R., Chong, T., McDowell, J.H., Smith, W.C., 2016. A splice variant of Bardet-Biedl syndrome 5 (BBS5) protein that is selectively expressed in retina. PLoS One 11. Brackley, K.I., Grantham, J., 2010. Subunits of the chaperonin CCT interact with F-actin and influence cell shape and cytoskeletal assembly. Exp. Cell Res. 316, 543–553. Caceres, P.S., Rodriguez-Boulan, E., 2020. Retinal pigment epithelium polarity in health and blinding diseases. Curr. Opin. Cell Biol. 49 References Castro-Sánchez, S., Álvarez-Satta, M., Cortón, M., Guillén, E., Ayuso, C., Valverde, D., 2015. Exploring genotype-phenotype relationships in Bardet-Biedl syndrome families. J. Med. Genet. 52, 503–513. Cavallo, R.A., Cox, R.T., Moline, M.M., Roose, J., Polevoy, G.A., Clevers, H., Peifer, M., Bejsovec, A., 1998. Drosophila Tcf and Groucho interact to repress wingless signalling activity. Nature 395, 604–608. Chen, H.Y., Kelley, R.A., Li, T., Swaroop, A., 2021. Primary cilia biogenesis and associated retinal ciliopathies. Semin. Cell Dev. Biol. Chen, X., Wang, C., Jiang, Y., Wang, Q., Tao, Y., Zhang, H., Zhao, Y., Hu, Y., Li, C., Ye, D., Liu, D., Jiang, W., Chin, E.Y., Chen, S., Liu, Y., Wang, M., Liu, S., Zhang, X., 2020. Bcl- 3 promotes Wnt signaling by maintaining the acetylation of β-catenin at lysine 49 in colorectal cancer. Signal Transduct. Target. Ther. 5. Chou, H.T., Apelt, L., Farrell, D.P., White, S.R., Woodsmith, J., Svetlov, V., Goldstein, J.S., Nager, A.R., Li, Z., Muller, J., Dollfus, H., Nudler, E., Stelzl, U., DiMaio, F., Nachury, M. V., Walz, T., 2019. The Molecular Architecture of Native BBSome Obtained by an Integrated Structural Approach. Structure 27, 1384-1394.e4. Clay, G.E., 1933. Laurence-Moon-Biedl Syndrome. Trans. Am. Ophthalmol. Soc. 31, 274–88. Cong, F., Schweizer, L., Varmus, H., 2004. Wnt signals across the plasma membrane to activate the β-catenin pathway by forming oligomers containing its receptors, Frizzled and LRP. Development 131, 5103–5115. Copeland, S.J., McRae, A., Guarguaglini, G., Trinkle-Mulcahy, L., Copeland, J.W., 2018. Actin-dependent regulation of cilia length by the inverted formin FHDC1. Mol. Biol. Cell 29, 1611–1627. Corbit, K.C., Shyer, A.E., Dowdle, W.E., Gaulden, J., Singla, V., Reiter, J.F., 2008. Kif3a constrains β-catenin-dependent Wnt signalling through dual ciliary and non-ciliary mechanisms. Nat. Cell Biol. 10, 70–76. 50 References Corral-serrano, J.C., Lamers, I.J.C., Reeuwijk, J. Van, Duijkers, L., Hoogendoorn, A.D.M., Yildirim, A., Argyrou, N., Ruigrok, R.A.A., Letteboer, J.F., Butcher, R., Essen, M.D. Van, Sakami, S., Palczewski, K., Cheetham, M.E., Liu, Q., Boldt, K., Ueffing, M., Garanto, A., 2020. PCARE and WASF3 regulate ciliary F-actin assembly that is required for the initiation of photoreceptor outer segment disk formation. Proc. Natl. Acad. Sci. U. S. A. 117, 9922–9931. Cruciat, C.M., Niehrs, C., 2013. Secreted and transmembrane Wnt inhibitors and activators. Cold Spring Harb. Perspect. Biol. 5. Cselenyi, C.S., Jernigan, K.K., Tahinci, E., Thorne, C.A., Lee, L.A., Lee, E., 2008. LRP6 transduces a canonical Wnt signal independently of Axin degradation by inhibiting GSK3’s phosphorylation of β-catenin. Proc. Natl. Acad. Sci. U. S. A. 105, 8032–8037. Cui, C., Chatterjee, B., Lozito, T.P., Zhang, Z., Francis, R.J., Yagi, H., Swanhart, L.M., Sanker, S., Francis, D., Yu, Q., San Agustin, J.T., Puligilla, C., Chatterjee, T., Tansey, T., Liu, X., Kelley, M.W., Spiliotis, E.T., Kwiatkowski, A. V., Tuan, R., Pazour, G.J., Hukriede, N.A., Lo, C.W., 2013. Wdpcp, a PCP Protein Required for Ciliogenesis, Regulates Directional Cell Migration and Cell Polarity by Direct Modulation of the Actin Cytoskeleton. PLoS Biol. 11, e1001720. Cusseddu, R., Robert, A., Côté, J.F., 2021. Strength Through Unity: The Power of the Mega- Scaffold MACF1. Front. Cell Dev. Biol. Daniels, A.B., Sandberg, M.A., Chen, J., Weigel-DiFranco, C., Hejtmancik, J.F., Berson, E.L., 2012. Genotype-phenotype correlations in Bardet-Biedl syndrome. Arch. Ophthalmol. 130, 901–907. Datta, P., Allamargot, C., Hudson, J.S., Andersen, E.K., Bhattarai, S., Drack, A. V., Sheffield, V.C., Seo, S., 2015. Accumulation of non-outer segment proteins in the outer segment underlies photoreceptor degeneration in Bardet-Biedl syndrome. Proc. Natl. Acad. Sci. U. S. A. 112, E4400–E4409. Davidson, G., Wu, W., Shen, J., Bilic, J., Fenger, U., Stannek, P., Glinka, A., Niehrs, C., 2005. Casein kinase 1γ couples Wnt receptor activation to cytoplasmic signal transduction. Nature 438, 867–872. 51 References Dawe, H.R., Adams, M., Wheway, G., Szymanska, K., Logan, C. V., Noegel, A.A., Gull, K., Johnson, C.A., 2009. Nesprin-2 interacts with meckelin and mediates ciliogenesis via remodelling of the actin cytoskeleton. J. Cell Sci. 122, 2716–2726. Delaval, B., Bright, A., Lawson, N.D., Doxsey, S., 2011. The cilia protein IFT88 is required for spindle orientation in mitosis. Nat. Cell Biol. 13, 461–470. Deveault, C., Billingsley, G., Duncan, J.L., Bin, J., Theal, R., Vincent, A., Fieggen, K.J., Gerth, C., Noordeh, N., Traboulsi, E.I., Fishman, G.A., Chitayat, D., Knueppel, T., Millán, J.M., Munier, F.L., Kennedy, D., Jacobson, S.G., Innes, A.M., Mitchell, G.A., Boycott, K., Héon, E., 2011. BBS genotype-phenotype assessment of a multiethnic patient cohort calls for a revision of the disease definition. Hum. Mutat. 32, 610–619. Dilan, T.L., Singh, R.K., Saravanan, T., Moye, A., Goldberg, A.F.X., Stoilov, P., Ramamurthy, V., 2018. Bardet-Biedl syndrome-8 (BBS8) protein is crucial for the development of outer segments in photoreceptor neurons. Hum. Mol. Genet. 27, 283–294. Doneray, H., Orbak, Z., 2006. Splenic lobulations in Bardet-Biedl syndrome: A first case report. Genet. Couns. 17, 295–300. Dunn, A.Y., Melville, M.W., Frydman, J., 2001. Review: Cellular substrates of the eukaryotic chaperonin TRiC/CCT. J. Struct. Biol. Fan, J., You, L., Wang, W., Huang, W., Chu, C., Chi, Y., Chen, H., 2020. Lamin A‐mediated nuclear lamina integrity is required for proper ciliogenesis. EMBO Rep. 21. Farina, F., Gaillard, J., Guérin, C., Couté, Y., Sillibourne, J., Blanchoin, L., Théry, M., 2016. The centrosome is an actin-organizing centre. Nat. Cell Biol. 18, 65–75. Finetti, F., Paccani, S.R., Riparbelli, M.G., Giacomello, E., Perinetti, G., Pazour, G.J., Rosenbaum, J.L., Baldari, C.T., 2009. Intraflagellar transport is required for polarized recycling of the TCR/CD3 complex to the immune synapse. Nat. Cell Biol. 11, 1332– 1339. Flack, J.E., Mieszczanek, J., Novcic, N., Bienz, M., 2017. Wnt-Dependent Inactivation of the Groucho/TLE Co-repressor by the HECT E3 Ubiquitin Ligase Hyd/UBR5. Mol. Cell 67, 181-193.e5. Florea, L., Caba, L., Gorduza, E.V., 2021. Bardet–biedl syndrome—multiple kaleidoscope images: Insight into mechanisms of genotype–phenotype correlations. Genes (Basel). 52 References Focșa, I.O., Budișteanu, M., Bălgrădean, M., 2021. Clinical and genetic heterogeneity of primary ciliopathies (Review). Int. J. Mol. Med. Forsythe, E., Beales, P.L., 2013. Bardet-Biedl syndrome. Eur. J. Hum. Genet. 21, 8–13. Forsythe, E., Sparks, K., Hoskins, B.E., Bagkeris, E., Mcgowan, B.M., Carroll, P. V., Huda, M.S.B., Mujahid, S., Peters, C., Barrett, T., Mohammed, S., Beales, P.L., 2015. Genetic predictors of cardiovascular morbidity in Bardet-Biedl syndrome. Clin. Genet. 87, 343– 349. Gascue, C., Tan, P.L., Cardenas-Rodriguez, M., Libisch, G., Fernandez-Calero, T., Liu, Y.P., Astrada, S., Robello, C., Naya, H., Katsanis, N., Badano, J.L., 2012. Direct role of Bardet- Biedl syndrome proteins in transcriptional regulation. J. Cell Sci. 125, 362–375. Gerdes, J.M., Liu, Y., Zaghloul, N.A., Leitch, C.C., Lawson, S.S., Kato, M., Beachy, P.A., Beales, P.L., DeMartino, G.N., Fisher, S., Badano, J.L., Katsanis, N., 2007. Disruption of the basal body compromises proteasomal function and perturbs intracellular Wnt response. Nat. Genet. 39, 1350–1360. Gong, Y., Mo, C., Fraser, S.E., 2004. Planar cell polarity signalling controls cell division orientation during zebrafish gastrulation. Nature 430, 689–693. Haag, N., Schüler, S., Nietzsche, S., Hübner, C.A., Strenzke, N., Qualmann, B., Kessels, M.M., 2018. The Actin Nucleator Cobl Is Critical for Centriolar Positioning, Postnatal Planar Cell Polarity Refinement, and Function of the Cochlea. Cell Rep. 24, 2418–2431. Habas, R., Kato, Y., He, X., 2001. Wnt/Frizzled activation of Rho regulates vertebrate gastrulation and requires a novel formin homology protein Daam1. Cell 107, 843–854. Hart, M., Concordet, J.P., Lassot, I., Albert, I., Del Los Santos, R., Durand, H., Perret, C., Rubinfeld, B., Margottin, F., Benarous, R., Polakis, P., 1999. The F-box protein β-TrCP associates with phosphorylated β-catenin and regulates its activity in the cell. Curr. Biol. 9, 207–211. Hashimoto, Y., Parsons, M., Adams, J.C., 2007. Dual actin-bundling and protein kinase C- binding activities of fascin regulate carcinoma cell migration downstream of Rac and contribute to metastasis. Mol. Biol. Cell 18, 4591–4602. 53 References Haward, F., Maslon, M.M., Yeyati, P.L., Bellora, N., Hansen, J.N., Aitken, S., Lawson, J., von Kriegsheim, A., Wachten, D., Mill, P., Adams, I.R., Caceres, J.F., 2021. Nucleo- cytoplasmic shuttling of splicing factor srsf1 is required for development and cilia function. Elife 10. Heon, E., Kim, G., Qin, S., Garrison, J.E., Tavares, E., Vincent, A., Nuangchamnong, N., Anthony Scott, C., Slusarski, D.C., Sheffield, V.C., 2016. Mutations in C8ORF37 cause Bardet Biedl syndrome (BBS21). Hum. Mol. Genet. 25, 2283–2294. Hernandez-Hernandez, V., Pravincumar, P., Diaz-Font, A., May-Simera, H., Jenkins, D., Knight, M., Beales, P.L., 2013. Bardet-biedl syndrome proteins control the cilia length through regulation of actin polymerization. Hum. Mol. Genet. 22, 3858–3868. Hildebrandt, F., Benzing, T., Katsanis, N., 2011. Ciliopathies. N. Engl. J. Med. 364, 1533– 1543. Hirayama, M., Wei, F.Y., Chujo, T., Oki, S., Yakita, M., Kobayashi, D., Araki, N., Takahashi, N., Yoshida, R., Nakayama, H., Tomizawa, K., 2020. FTO Demethylates Cyclin D1 mRNA and Controls Cell-Cycle Progression. Cell Rep. 31. Hoffmans, R., Basler, K., 2007. BCL9-2 binds Arm/β-catenin in a Tyr142-independent manner and requires Pygopus for its function in Wg/Wnt signaling. Mech. Dev. 124, 59–67. Hoffmeyer, K., Junghans, D., Kanzler, B., Kemler, R., 2017. Trimethylation and Acetylation of β-Catenin at Lysine 49 Represent Key Elements in ESC Pluripotency. Cell Rep. 18, 2815–2824. Hong, H., Kiim, J., Kim, J., 2015. Myosin heavy chain 10 (MYH10) is required for centriole migration during the biogenesis of primary cilia. Biochem. Biophys. Res. Commun. 461, 180–185. Hsu, Y., Seo, S., Sheffield, V.C., 2021. Photoreceptor cilia, in contrast to primary cilia, grant entry to a partially assembled BBSome. Hum. Mol. Genet. 30, 87–102. Huang, N., Xia, Y., Zhang, D., Wang, S., Bao, Y., He, R., Teng, J., Chen, J., 2017. Hierarchical assembly of centriole subdistal appendages via centrosome binding proteins CCDC120 and CCDC68. Nat. Commun. 8, 15057. 54 References Humphries, J.D., Wang, P., Streuli, C., Geiger, B., Humphries, M.J., Ballestrem, C., 2007. Vinculin controls focal adhesion formation by direct interactions with talin and actin. J. Cell Biol. 179, 1043–1057. Iaconelli, J., Huang, J.H., Berkovitch, S.S., Chattopadhyay, S., Mazitschek, R., Schreiber, S.L., Haggarty, S.J., Karmacharya, R., 2015. HDAC6 Inhibitors modulate lys49 acetylation and membrane localization of -catenin in human ipsc-derived neuronal cells. ACS Chem. Biol. 10, 883–890. Ikeda, S., Kishida, S., Yamamoto, H., Murai, H., Koyama, S., Kikuchi, A., 1998. Axin, a negative regulator of the Wnt signaling pathway, forms a complex with GSK-3β and β- catenin and promotes GSK-3β-dependent phosphorylation of β-catenin. EMBO J. 17, 1371–1384. Imhoff, O., Marion, V., Stoetzel, C., Durand, M., Holder, M., Sigaudy, S., Sarda, P., Hamel, C.P., Brandt, C., Dollfus, H., Moulin, B., 2011. Bardet-biedl syndrome: A study of the renal and cardiovascular phenotypes in a French cohort. Clin. J. Am. Soc. Nephrol. 6, 22– 29. Jacquemet, G., Hamidi, H., Ivaska, J., 2019. Filopodia quantification using filoquant, in: Methods in Molecular Biology. Humana Press Inc., pp. 359–373. Jayo, A., Malboubi, M., Antoku, S., Chang, W., Ortiz-Zapater, E., Groen, C., Pfisterer, K., Tootle, T., Charras, G., Gundersen, G.G., Parsons, M., 2016. Fascin Regulates Nuclear Movement and Deformation in Migrating Cells. Dev. Cell 38, 371–383. Jayo, A., Parsons, M., 2010. Fascin: A key regulator of cytoskeletal dynamics. Int. J. Biochem. Cell Biol. Jin, H., White, S.R., Shida, T., Schulz, S., Aguiar, M., Gygi, S.P., Bazan, J.F., Nachury, M. V., 2010. The conserved Bardet-Biedl Syndrome proteins assemble a coat that traffics membrane proteins to cilia. Cell 141, 1208–1219. Katsanis, N., 2004. The oligogenic properties of Bardet-Biedl syndrome. Hum. Mol. Genet. Kee, H.L., Dishinger, J.F., Lynne Blasius, T., Liu, C.J., Margolis, B., Verhey, K.J., 2012. A size-exclusion permeability barrier and nucleoporins characterize a ciliary pore complex that regulates transport into cilia. Nat. Cell Biol. 14, 431–437. 55 References Kiesel, P., Alvarez Viar, G., Tsoy, N., Maraspini, R., Gorilak, P., Varga, V., Honigmann, A., Pigino, G., 2020. The molecular structure of mammalian primary cilia revealed by cryo- electron tomography. Nat. Struct. Mol. Biol. 1–10. Kikuchi, A., Yamamoto, H., Kishida, S., 2007. Multiplicity of the interactions of Wnt proteins and their receptors. Cell. Signal. Kim, J., Lee, J.E., Heynen-Genel, S., Suyama, E., Ono, K., Lee, K., Ideker, T., Aza-Blanc, P., Gleeson, J.G., 2010. Functional genomic screen for modulators of ciliogenesis and cilium length. Nature 464, 1048–1051. Kim, J.C., Ou, Y.Y., Badano, J.L., Esmail, M. a, Leitch, C.C., Fiedrich, E., Beales, P.L., Archibald, J.M., Katsanis, N., Rattner, J.B., Leroux, M.R., 2005. MKKS/BBS6, a divergent chaperonin-like protein linked to the obesity disorder Bardet-Biedl syndrome, is a novel centrosomal component required for cytokinesis. J. Cell Sci. 118, 1007–20. Kim, Jongshin, Jo, H., Hong, H., Kim, M.H., Kim, J.M., Lee, J.K., Heo, W. Do, Kim, Joon, 2015. Actin remodelling factors control ciliogenesis by regulating YAP/TAZ activity and vesicle trafficking. Nat. Commun. 6, 6781. Kim, S.K., Shindo, A., Park, T.J., Oh, E.C., Ghosh, S., Gray, R.S., Lewis, R.A., Johnson, C.A., Attie-Bittach, T., Katsanis, N., Wallingford, J.B., 2010. Planar cell polarity acts through septins to control collective cell movement and ciliogenesis. Science (80-. ). 329, 1337– 1340. Kishida, S., Yamamoto, H., Ikeda, S., Kishida, M., Sakamoto, I., Koyama, S., Kikuchi, A., 1998. Axin, a negative regulator of the Wnt signaling pathway, directly interacts with adenomatous polyposis coli and regulates the stabilization of β-catenin. J. Biol. Chem. 273, 10823–10826. Krasnow, R.E., Wong, L.L., Adler, P.N., 1995. Dishevelled is a component of the frizzled signaling pathway in Drosophila. Development 121, 4095–4102. Kretschmer, V., May-Simera, H.L., 2020. The Role of WNT Signaling during Ciliary- Dependent RPE Development. Klin. Monbl. Augenheilkd. 237, 248–258. Kretschmer, V., Patnaik, S.R., Kretschmer, F., Chawda, M.M., Hernandez-Hernandez, V., May-Simera, H.L., 2019. Progressive characterization of visual phenotype in bardet-biedl syndrome mutant mice. Investig. Ophthalmol. Vis. Sci. 60, 1132–1143. 56 References Kudryashova, E., Kudryashov, D., Kramerova, I., Spencer, M.J., 2005. Trim32 is a ubiquitin ligase mutated in limb girdle muscular dystrophy type 2H that binds to skeletal muscle myosin and ubiquitinates actin. J. Mol. Biol. 354, 413–424. Kyun, M.L., Kim, S.O., Lee, H.G., Hwang, J.A., Hwang, J., Soung, N.K., Cha-Molstad, H., Lee, S., Kwon, Y.T., Kim, B.Y., Lee, K.H., 2020. Wnt3a Stimulation Promotes Primary Ciliogenesis through β-Catenin Phosphorylation-Induced Reorganization of Centriolar Satellites. Cell Rep. 30, 1447-1462.e5. Lai, F.P.L., Szczodrak, M., Block, J., Faix, J., Breitsprecher, D., Mannherz, H.G., Stradal, T.E.B., Dunn, G.A., Small, J.V., Rottner, K., 2008. Arp2/3 complex interactions and actin network turnover in lamellipodia. EMBO J. 27, 982–992. Lai, Y., Jiang, Y., 2020. Reciprocal regulation between primary cilia and mtorc1. Genes (Basel). Lechtreck, K.F., Johnson, E.C., Sakai, T., Cochran, D., Ballif, B.A., Rush, J., Pazour, G.J., Ikebe, M., Witman, G.B., 2009. The Chlamydomonas reinhardtii BBSome is an IFT cargo required for export of specific signaling proteins from flagella. J. Cell Biol. 187, 1117– 1132. Lee, K.H., 2020. Involvement of Wnt signaling in primary cilia assembly and disassembly. FEBS J. 287, 5027–5038. Lee, S., Tan, H.Y., Geneva, I.I., Kruglov, A., Calvert, P.D., 2018. Actin filaments partition primary cilia membranes into distinct fluid corrals. J. Cell Biol. 217, 2831–2849. Leitch, C.C., Lodh, S., Prieto-Echagüe, V., Badano, J.L., Zaghloul, N.A., 2014. Basal body proteins regulate Notch signaling through endosomal trafficking. J. Cell Sci. 127, 2407– 2419. Letort, G., Ennomani, H., Gressin, L., Théry, M., Blanchoin, L., 2015. Dynamic reorganization of the actin cytoskeleton. F1000Research. Li, A., Xu, Y., Fan, S., Meng, J., Shen, X., Xiao, Q., Li, Y., Zhang, L., Zhang, X., Wu, G., Liang, C., Wu, D., 2018. Canonical Wnt inhibitors ameliorate cystogenesis in a mouse ortholog of human ADPKD. JCI insight 3. Li, D., Liu, Y., Yi, P., Zhu, Z., Li, W., Zhang, Q.C., Li, J.B., Ou, G., 2021. RNA editing restricts hyperactive ciliary kinases. Science (80-. ). 373, 984–991. 57 References Li, L., Gao, S., Wang, L., Bu, T., Chu, J., Lv, L., Tahir, A., Mao, B., Li, H., Li, X., Wang, Y., Wu, X., Ge, R., Cheng, C.Y., 2022. PCP Protein Inversin Regulates Testis Function Through Changes in Cytoskeletal Organization of Actin and Microtubules. Endocrinology 163, 1–20. Li, X., 2011. Epigenetics and autosomal dominant polycystic kidney disease. Biochim. Biophys. Acta - Mol. Basis Dis. Li, X., Lu, Q., Peng, Y., Geng, F., Shao, X., Zhou, H., Cao, Y., Zhang, R., 2020. Primary cilia mediate Klf2-dependant Notch activation in regenerating heart. Protein Cell 11, 433–445. Li, Y., Zhang, X., Polakiewicz, R.D., Yao, T.P., Comb, M.J., 2008. HDAC6 is required for epidermal growth factor-induced β-catenin nuclear localization. J. Biol. Chem. 283, 12686–12690. Liang, Y., Meng, D., Zhu, B., Pan, J., 2016. Mechanism of ciliary disassembly. Cell. Mol. Life Sci. 73, 1787–1802. Lienkamp, S., Ganner, A., Walz, G., 2012. Inversin, Wnt signaling and primary cilia. Differentiation 83, S49–S55. Liew, G.M., Ye, F., Nager, A.R., Murphy, J.P., Lee, J.S., Aguiar, M., Breslow, D.K., Gygi, S.P., Nachury, M. V., 2014. The Intraflagellar Transport Protein IFT27 Promotes BBSome Exit from Cilia through the GTPase ARL6/BBS3. Dev. Cell 31, 265–278. Lin, H., Zhang, Z., Iomini, C., Dutcher, S.K., 2018. Identifying RNA splicing factors using IFT genes in Chlamydomonas reinhardtii. Open Biol. 8. Lin, X., Xiao, Y., Chen, Z., Ma, J., Qiu, W., Zhang, K., Xu, F., Dang, K., Qian, A., 2019. Microtubule actin crosslinking factor 1 (MACF1) knockdown inhibits RANKL-induced osteoclastogenesis via Akt/GSK3β/NFATc1 signalling pathway. Mol. Cell. Endocrinol. 494. Lindstrand, A., Frangakis, S., Carvalho, C.M.B., Richardson, E.B., McFadden, K.A., Willer, J.R., Pehlivan, D., Liu, P., Pediaditakis, I.L., Sabo, A., Lewis, R.A., Banin, E., Lupski, J.R., Davis, E.E., Katsanis, N., 2016. Copy-Number Variation Contributes to the Mutational Load of Bardet-Biedl Syndrome. Am. J. Hum. Genet. 99, 318–336. 58 References Liu, C., Li, Y., Semenov, M., Han, C., Baeg, G.H., Tan, Y., Zhang, Z., Lin, X., He, X., 2002. Control of β-catenin phosphorylation/degradation by a dual-kinase mechanism. Cell 108, 837–847. Liu, E., Zhou, Q., Xie, A., Li, X., Li, M., Ye, J., Li, S., Ke, D., Wang, Q., Xu, Z., Li, L., Yang, Y., Liu, G., Wang, X., Li, H., Wang, J., 2020. Tau acetylates and stabilizes β‐catenin thereby promoting cell survival. EMBO Rep. 21. Liu, W., Sato, A., Khadka, D., Bharti, R., Diaz, H., Runnels, L.W., Habas, R., 2008. Mechanism of activation of the Formin protein Daam1. Proc. Natl. Acad. Sci. U. S. A. 105, 210–215. Liu, Y.P., Tsai, I.C., Morleo, M., Oh, E.C., Leitch, C.C., Massa, F., Lee, B.H., Parker, D.S., Finley, D., Zaghloul, N.A., Franco, B., Katsanis, N., 2014. Ciliopathy proteins regulate paracrine signaling by modulating proteasomal degradation of mediators. J. Clin. Invest. 124, 2059–2070. Loktev, A. V., Zhang, Q., Beck, J.S., Searby, C.C., Scheetz, T.E., Bazan, J.F., Slusarski, D.C., Sheffield, V.C., Jackson, P.K., Nachury, M. V., 2008. A BBSome Subunit Links Ciliogenesis, Microtubule Stability, and Acetylation. Dev. Cell 15, 854–865. Lu, Q., Insinna, C., Ott, C., Stauffer, J., Pintado, P.A., Rahajeng, J., Baxa, U., Walia, V., Cuenca, A., Hwang, Y.S., Daar, I.O., Lopes, S., Lippincott-Schwartz, J., Jackson, P.K., Caplan, S., Westlake, C.J., 2015. Early steps in primary cilium assembly require EHD1/EHD3-dependent ciliary vesicle formation. Nat. Cell Biol. 17, 228–240. Luo, W. wei, Chen, B.J., Wang, Y. mei, Yang, J. mei, Liu, X., Yuan, Y. sheng, Lin, X., Chi, F. lu, Chen, P., Ren, D. dong, 2020. Planar cell polarity governs the alignment of the nasopharyngeal epithelium in mammals. FEBS J. Ma, Y., Li, A., Faller, W.J., Libertini, S., Fiorito, F., Gillespie, D.A., Sansom, O.J., Yamashiro, S., Machesky, L.M., 2013. Fascin 1 is transiently expressed in mouse melanoblasts during development and promotes migration and proliferation. Dev. 140, 2203–2211. Manara, E., Paolacci, S., D’esposito, F., Abeshi, A., Ziccardi, L., Falsini, B., Colombo, L., Iarossi, G., Pilotta, A., Boccone, L., Guerri, G., Monica, M., Marta, B., Maltese, P.E., Buzzonetti, L., Rossetti, L., Bertelli, M., 2019. Mutation profile of BBS genes in patients with Bardet-Biedl syndrome: An Italian study. Ital. J. Pediatr. 45. 59 References Maxwell, D.W., O’Keefe, R.T., Roy, S., Hentges, K.E., 2021. The role of splicing factors in retinitis pigmentosa: Links to cilia. Biochem. Soc. Trans. May-Simera, H., 2016. Evaluation of planar-cell-polarity phenotypes in ciliopathy mouse mutant cochlea. J. Vis. Exp. 53559. May-Simera, H., Nagel-Wolfrum, K., Wolfrum, U., 2017. Cilia - The sensory antennae in the eye. Prog. Retin. Eye Res. 60, 144–180. May-Simera, H.L., Gumerson, J.D., Gao, C., Campos, M., Cologna, S.M., Beyer, T., Boldt, K., Kaya, K.D., Patel, N., Kretschmer, F., Kelley, M.W., Petralia, R.S., Davey, M.G., Li, T., 2016. Loss of MACF1 Abolishes Ciliogenesis and Disrupts Apicobasal Polarity Establishment in the Retina. Cell Rep. 17, 1399–1413. May-Simera, H.L., Kai, M., Hernandez, V., Osborn, D.P.S., Tada, M., Beales, P.L., 2010. Bbs8, together with the planar cell polarity protein Vangl2, is required to establish left-right asymmetry in zebrafish. Dev. Biol. 345, 215–225. May-Simera, H.L., Kelley, M.W., 2012. Cilia, Wnt signaling, and the cytoskeleton. Cilia 1, 7. May-Simera, H.L., Petralia, R.S., Montcouquiol, M., Wang, Y.-X., Szarama, K.B., Liu, Y., Lin, W., Deans, M.R., Pazour, G.J., Kelley, M.W., 2015. Ciliary proteins Bbs8 and Ift20 promote planar cell polarity in the cochlea. Development 142, 555–566. May-Simera, H.L., Ross, A., Rix, S., Forge, A., Beales, P.L., Jagger, D.J., 2009. Patterns of expression of Bardet-Biedl syndrome proteins in the mammalian cochlea suggest noncentrosomal functions. J. Comp. Neurol. 514, 174–188. May-Simera, H.L., Wan, Q., Jha, B.S., Hartford, J., Khristov, V., Dejene, R., Chang, J., Patnaik, S., Lu, Q., Banerjee, P., Silver, J., Insinna-Kettenhofen, C., Patel, D., Lotfi, M., Hotaling, May Malicdan, N., Maminishkis, A., Sridharan, R., Brooks, B., Miyagishima, K., Gunay‐ Aygun, M., Pal, R., Westlake, C., Miller, S., Sharma, R., Bharti, K., 2018. Primary Cilium Mediated Retinal Pigment Epithelium Maturation is Retarded in Ciliopathy Patient Cells. CellReports 22, 189–205. Mazzoni, F., Safa, H., Finnemann, S.C., 2014. Understanding photoreceptor outer segment phagocytosis: Use and utility of RPE cells in culture. Exp. Eye Res. 126, 51–60. McConnachie, D.J., Stow, J.L., Mallett, A.J., 2021. Ciliopathies and the Kidney: A Review. Am. J. Kidney Dis. 60 References McMurray, R.J., Wann, A.K.T., Thompson, C.L., Connelly, J.T., Knight, M.M., 2013. Surface topography regulates wnt signaling through control of primary cilia structure in mesenchymal stem cells. Sci. Rep. 3, 3545. Mergen, M., Engel, C., Müller, B., Follo, M., Schäfer, T., Jung, M., Walz, G., 2013. The nephronophthisis gene product NPHP2/Inversin interacts with Aurora A and interferes with HDAC6-mediated cilia disassembly. Nephrol. Dial. Transplant. 28, 2744–2753. Minegishi, K., Hashimoto, M., Ajima, R., Takaoka, K., Shinohara, K., Ikawa, Y., Nishimura, H., McMahon, A.P., Willert, K., Okada, Y., Sasaki, H., Shi, D., Fujimori, T., Ohtsuka, T., Igarashi, Y., Yamaguchi, T.P., Shimono, A., Shiratori, H., Hamada, H., 2017. A Wnt5 Activity Asymmetry and Intercellular Signaling via PCP Proteins Polarize Node Cells for Left-Right Symmetry Breaking. Dev. Cell 40, 439–452. Molenaar, M., Van De Wetering, M., Oosterwegel, M., Peterson-Maduro, J., Godsave, S., Korinek, V., Roose, J., Destrée, O., Clevers, H., 1996. XTcf-3 transcription factor mediates β-catenin-induced axis formation in xenopus embryos. Cell 86, 391–399. Molla-Herman, A., Ghossoub, R., Blisnick, T., Meunier, A., Serres, C., Silbermann, F., Emmerson, C., Romeo, K., Bourdoncle, P., Schmitt, A., Saunier, S., Spassky, N., Bastin, P., Benmerah, A., 2010. The ciliary pocket: An endocytic membrane domain at the base of primary and motile cilia. J. Cell Sci. 123, 1785–1795. Morisada, N., Hamada, R., Miura, K., Ye, M.J., Nozu, K., Hattori, M., Iijima, K., 2020. Bardet- Biedl syndrome in two unrelated patients with identical compound heterozygous SCLT1 mutations. CEN case reports 9, 260–265. Mukherjee, K., Conway De MacArio, E., MacArio, A.J.L., Brocchieri, L., 2010. Chaperonin genes on the rise: New divergent classes and intense duplication in human and other vertebrate genomes. BMC Evol. Biol. 10. Muller, J., Stoetzel, C., Vincent, M.C., Leitch, C.C., Laurier, V., Danse, J.M., Hellé, S., Marion, V., Bennouna-Greene, V., Vicaire, S., Megarbane, A., Kaplan, J., Drouin-Garraud, V., Hamdani, M., Sigaudy, S., Francannet, C., Roume, J., Bitoun, P., Goldenberg, A., Philip, N., Odent, S., Green, J., Cossée, M., Davis, E.E., Katsanis, N., Bonneau, D., Verloes, A., Poch, O., Mandel, J.L., Dollfus, H., 2010. Identification of 28 novel mutations in the Bardet-Biedl syndrome genes: The burden of private mutations in an extensively heterogeneous disease. Hum. Genet. 127, 583–593. 61 References Munnamalai, V., Fekete, D.M., 2013. Wnt signaling during cochlear development. Semin. Cell Dev. Biol. Nachury, M. V., Loktev, A. V., Zhang, Q., Westlake, C.J., Peränen, J., Merdes, A., Slusarski, D.C., Scheller, R.H., Bazan, J.F., Sheffield, V.C., Jackson, P.K., 2007. A Core Complex of BBS Proteins Cooperates with the GTPase Rab8 to Promote Ciliary Membrane Biogenesis. Cell 129, 1201–1213. Nager, A.R., Goldstein, J.S., Herranz-Pérez, V., Portran, D., Ye, F., Garcia-Verdugo, J.M., Nachury, M. V., 2017. An Actin Network Dispatches Ciliary GPCRs into Extracellular Vesicles to Modulate Signaling. Cell 168, 252–263. Niederlova, V., Modrak, M., Tsyklauri, O., Huranova, M., Stepanek, O., 2019. Meta-analysis of genotype-phenotype associations in Bardet-Biedl syndrome uncovers differences among causative genes. Hum. Mutat. 40, 2068–2087. Nozaki, S., Francisco, R., Araya, C., Katoh, Y., Nakayama, K., 2019. Requirement of IFT-B– BBSome complex interaction in export of GPR161 from cilia. Biol. Open 8. O’Connor, M.J., Thakar, T., Nicolae, C.M., Moldovan, G.L., 2021. PARP14 regulates cyclin D1 expression to promote cell-cycle progression. Oncogene 40, 4872–4883. O’Regan, L., Blot, J., Fry, A.M., 2007. Mitotic regulation by NIMA-related kinases. Cell Div. 2, 25. Obino, D., Farina, F., Malbec, O., Sáez, P.J., Maurin, M., Gaillard, J., Dingli, F., Loew, D., Gautreau, A., Yuseff, M.I., Blanchoin, L., Théry, M., Lennon-Duménil, A.M., 2016. Actin nucleation at the centrosome controls lymphocyte polarity. Nat. Commun. 7, 10969. Okamoto, M., Udagawa, N., Uehara, S., Maeda, K., Yamashita, T., Nakamichi, Y., Kato, H., Saito, N., Minami, Y., Takahashi, N., Kobayashi, Y., 2014. Noncanonical Wnt5a enhances Wnt/β-catenin signaling during osteoblastogenesis. Sci. Rep. 4. Pan, J., You, Y., Huang, T., Brody, S.L., 2007. RhoA-mediated apical actin enrichment is required for ciliogenesis and promoted by Foxj1. J. Cell Sci. 120, 1868–1876. Park, H.W., Kim, Y.C., Yu, B., Moroishi, T., Mo, J.S., Plouffe, S.W., Meng, Z., Lin, K.C., Yu, F.X., Alexander, C.M., Wang, C.Y., Guan, K.L., 2015. Alternative Wnt Signaling Activates YAP/TAZ. Cell 162, 780–794. 62 References Pfisterer, K., Levitt, J., Lawson, C.D., Marsh, R.J., Heddleston, J.M., Wait, E., Ameer-Beg, S.M., Cox, S., Parsons, M., 2020. FMNL2 regulates dynamics of fascin in filopodia. J. Cell Biol. 219. Phua, S.C., Chiba, S., Suzuki, M., Su, E., Roberson, E.C., Pusapati, G. V., Setou, M., Rohatgi, R., Reiter, J.F., Ikegami, K., Inoue, T., 2017. Dynamic Remodeling of Membrane Composition Drives Cell Cycle through Primary Cilia Excision. Cell 168, 264–279. Piao, S., Lee, S.-H., Kim, H., Yum, S., Stamos, J.L., Xu, Y., Lee, S.-J., Lee, J., Oh, S., Han, J.- K., Park, B.-J., Weis, W.I., Ha, N.-C., 2008. Direct Inhibition of GSK3β by the Phosphorylated Cytoplasmic Domain of LRP6 in Wnt/β-Catenin Signaling. PLoS One 3, e4046. Pitaval, A., Tseng, Q., Bornens, M., Théry, M., 2010. Cell shape and contractility regulate ciliogenesis in cell cycle-arrested cells. J. Cell Biol. 191, 303–312. Ponce, D.P., Maturana, J.L., Cabello, P., Yefi, R., Niechi, I., Silva, E., Armisen, R., Galindo, M., Antonelli, M., Tapia, J.C., 2011. Phosphorylation of AKT/PKB by CK2 is necessary for the AKT-dependent up-regulation of β-catenin transcriptional activity. J. Cell. Physiol. 226, 1953–1959. Pugacheva, E.N., Jablonski, S.A., Hartman, T.R., Henske, E.P., Golemis, E.A., 2007. HEF1- Dependent Aurora A Activation Induces Disassembly of the Primary Cilium. Cell 129, 1351–1363. Qi, Z., Shen, Y., Fu, Q., Li, W., Yang, W., Xu, W., Chu, P., Zhang, Y., Wang, H., 2017. Whole- exome sequencing identified compound heterozygous variants in MMKS in a Chinese pedigree with Bardet-Biedl syndrome. Sci. China Life Sci. 60, 739–745. Riazuddin, S.A., Iqbal, M., Wang, Y., Masuda, T., Chen, Y., Bowne, S., Sullivan, L.S., Waseem, N.H., Bhattacharya, S., Daiger, S.P., Zhang, K., Khan, S.N., Riazuddin, S., Hejtmancik, J.F., Sieving, P.A., Zack, D.J., Katsanis, N., 2010. A Splice-Site Mutation in a Retina-Specific Exon of BBS8 Causes Nonsyndromic Retinitis Pigmentosa. Am. J. Hum. Genet. 86, 805–812. Ridley, A.J., Hall, A., 1992. The small GTP-binding protein rho regulates the assembly of focal adhesions and actin stress fibers in response to growth factors. Cell 70, 389–399. 63 References Roose, J., Molenaar, M., Peterson, J., Hurenkamp, J., Brantjes, H., Moerer, P., Van De Wetering, M., Destrée, O., Clevers, H., 1998. The Xenopus Wnt effector XTcf-3 interacts with Groucho-related transcriptional repressors. Nature 395, 608–612. Ross, A.J., May-Simera, H., Eichers, E.R., Kai, M., Hill, J., Jagger, D.J., Leitch, C.C., Chapple, J.P., Munro, P.M., Fisher, S., Tan, P.L., Phillips, H.M., Leroux, M.R., Henderson, D.J., Murdoch, J.N., Copp, A.J., Eliot, M.-M., Lupski, J.R., Kemp, D.T., Dollfus, H., Tada, M., Katsanis, N., Forge, A., Beales, P.L., 2005. Disruption of Bardet-Biedl syndrome ciliary proteins perturbs planar cell polarity in vertebrates. Nat. Genet. 37, 1135–1140. Rubinfeld, B., Albert, I., Porfiri, E., Fiol, C., Munemitsu, S., Polakis, P., 1996. Binding of GSK3β to the APC-β-catenin complex and regulation of complex assembly. Science (80- . ). 272, 1023–1026. Saito, M., Otsu, W., Hsu, K., Chuang, J., Yanagisawa, T., Shieh, V., Kaitsuka, T., Wei, F., Tomizawa, K., Sung, C., 2017. Tctex‐1 controls ciliary resorption by regulating branched actin polymerization and endocytosis. EMBO Rep. 18, 1460–1472. Sanchez-Soriano, N., Travis, M., Dajas-Bailador, F., Gonçalves-Pimentel, C., Whitmarsh, A.J., Prokop, A., 2009. Mouse ACF7 and Drosophila Short stop modulate filopodia formation and microtubule organisation during neuronal growth. J. Cell Sci. 122, 2534–2542. Sánchez, I., Dynlacht, B.D., 2016. Cilium assembly and disassembly. Nat. Cell Biol. 18, 711– 717. Satir, P., Christensen, S.T., 2007. Overview of Structure and Function of Mammalian Cilia. Annu. Rev. Physiol. 69, 377–400. Schaks, M., Döring, H., Kage, F., Steffen, A., Klünemann, T., Blankenfeldt, W., Stradal, T., Rottner, K., 2021. RhoG and Cdc42 can contribute to Rac-dependent lamellipodia formation through WAVE regulatory complex-binding. Small GTPases 12, 122–132. Schmidt, K.N., Kuhns, S., Neuner, A., Hub, B., Zentgraf, H., Pereira, G., 2012. Cep164 mediates vesicular docking to the mother centriole during early steps of ciliogenesis. J. Cell Biol. 199, 1083–1101. 64 References Schneider, S., De Cegli, R., Nagarajan, J., Kretschmer, V., Matthiessen, P.A., Intartaglia, D., Hotaling, N., Ueffing, M., Boldt, K., Conte, I., May-Simera, H.L., 2021. Loss of Ciliary Gene Bbs8 Results in Physiological Defects in the Retinal Pigment Epithelium. Front. Cell Dev. Biol. 9. Schofield, A. V., Gamell, C., Bernard, O., 2013. Tubulin polymerization promoting protein 1 (TPPP1) increases β-catenin expression through inhibition of HDAC6 activity in U2OS osteosarcoma cells. Biochem. Biophys. Res. Commun. 436, 571–577. Scholz, M., Weirich, K.L., Gardel, M.L., Dinner, A.R., Scholz, M., Weirich, K.L., Gardel, M.L., Dinner, A.R., Gardel, M.L., Dinner, A.R., Scholz, M., 2020. Tuning molecular motor transport through cytoskeletal filament network organization. Soft Matter 16, 2135– 2140. Scott, C.A., Marsden, A.N., Rebagliati, M.R., Zhang, Q., Chamling, X., Searby, C.C., Baye, L.M., Sheffield, V.C., Slusarski, D.C., 2017. Nuclear/cytoplasmic transport defects in BBS6 underlie congenital heart disease through perturbation of a chromatin remodeling protein. PLoS Genet. 13, 1–26. Semënov, M. V., Tamai, K., Brott, B.K., Kühl, M., Sokol, S., He, X., 2001. Head inducer dickkopf-1 is a ligand for Wnt coreceptor LRP6. Curr. Biol. 11, 951–961. Semënov, M. V., Zhang, X., He, X., 2008. DKK1 antagonizes Wnt signaling without promotion of LRP6 internalization and degradation. J. Biol. Chem. 283, 21427–21432. Seo, S., Baye, L.M., Schulz, N.P., Beck, J.S., Zhang, Q., Slusarski, D.C., Sheffield, V.C., 2010. BBS6, BBS10, and BBS12 form a complex with CCT/TRiC family chaperonins and mediate BBSome assembly. Proc. Natl. Acad. Sci. 107, 1488–1493. Shang, S., Hua, F., Hu, Z.W., 2017. The regulation of β-catenin activity and function in cancer: Therapeutic opportunities. Oncotarget. Simons, M., Gloy, J., Ganner, A., Bullerkotte, A., Bashkurov, M., Krönig, C., Schermer, B., Benzing, T., Cabello, O.A., Jenny, A., Mlodzik, M., Polok, B., Driever, W., Obara, T., Walz, G., 2005. Inversin, the gene product mutated in nephronophthisis type II, functions as a molecular switch between Wnt signaling pathways. Nat. Genet. 37, 537–543. Singh, S., Gui, M., Koh, F., Yip, M.C.J., Brown, A., 2020. Structure and activation mechanism of the BBsome membrane protein trafficking complex. Elife 9. 65 References Sinha, S., Belcastro, M., Datta, P., Seo, S., Sokolov, M., 2014. Essential role of the chaperonin CCT in rod outer segment biogenesis. Investig. Ophthalmol. Vis. Sci. 55, 3775–3784. Sorokin, S.P., 1968. Reconstructions of centriole formation and ciliogenesis in mammalian lungs. J. Cell Sci. 3, 207–30. Spencer, W.J., Lewis, T.R., Phan, S., Cady, M.A., Serebrovskaya, E.O., Schneider, N.F., Kim, K.Y., Cameron, L.A., Skiba, N.P., Ellisman, M.H., Arshavsky, V.Y., 2019. Photoreceptor disc membranes are formed through an Arp2/3-dependent lamellipodium-like mechanism. Proc. Natl. Acad. Sci. U. S. A. 116, 27043–27052. Stamos, J.L., Chu, M.L.H., Enos, M.D., Shah, N., Weis, W.I., 2014. Structural basis of GSK-3 inhibition by N-terminal phosphorylation and by the Wnt receptor LRP6. Elife 2014. Stoetzel, C., Laurier, V., Davis, E.E., Muller, J., Rix, S., Badano, J.L., Leitch, C.C., Salem, N., Chouery, E., Corbani, S., Jalk, N., Vicaire, S., Sarda, P., Hamel, C., Lacombe, D., Holder, M., Odent, S., Holder, S., Brooks, A.S., Elcioglu, N.H., Silva, E.D., Rossillion, B., Sigaudy, S., de Ravel, T.J.L., Lewis, R.A., Leheup, B., Verloes, A., Amati-Bonneau, P., Mégarbané, A., Poch, O., Bonneau, D., Beales, P.L., Mandel, J.-L., Katsanis, N., Dollfus, H., 2006. BBS10 encodes a vertebrate-specific chaperonin-like protein and is a major BBS locus. Nat. Genet. 38, 521–524. Stoetzel, C., Muller, J., Laurier, V., Davis, E.E., Zaghloul, N.A., Vicaire, S., Jacquelin, C., Plewniak, F., Leitch, C.C., Sarda, P., Hamel, C., de Ravel, T.J.L., Lewis, R.A., Friederich, E., Thibault, C., Danse, J.-M., Verloes, A., Bonneau, D., Katsanis, N., Poch, O., Mandel, J.-L., Dollfus, H., 2007. Identification of a novel BBS gene (BBS12) highlights the major role of a vertebrate-specific branch of chaperonin-related proteins in Bardet-Biedl syndrome. Am. J. Hum. Genet. 80, 1–11. Suizu, F., Hirata, N., Kimura, K., Edamura, T., Tanaka, T., Ishigaki, S., Donia, T., Noguchi, H., Iwanaga, T., Noguchi, M., 2016. Phosphorylation-dependent Akt – Inversin interaction at the basal body of primary cilia 35, 1–18. Sun, C., Zhou, J., Meng, X., 2021. Primary cilia in retinal pigment epithelium development and diseases. J. Cell. Mol. Med. Sustmann, C., Flach, H., Ebert, H., Eastman, Q., Grosschedl, R., 2008. Cell-Type-Specific Function of BCL9 Involves a Transcriptional Activation Domain That Synergizes with β- Catenin. Mol. Cell. Biol. 28, 3526–3537. 66 References Svanström, A., Grantham, J., 2016. The molecular chaperone CCT modulates the activity of the actin filament severing and capping protein gelsolin in vitro. Cell Stress Chaperones 21, 55–62. Tobin, J.L., Di Franco, M., Eichers, E., May-Simera, H., Garcia, M., Yan, J., Quinlan, R., Justice, M.J., Hennekam, R.C., Briscoe, J., Tada, M., Mayor, R., Burns, A.J., Lupski, J.R., Hammond, P., Beales, P.L., 2008. Inhibition of neural crest migration underlies craniofacial dysmorphology and Hirschsprung’s disease in Bardet-Biedl syndrome. Proc. Natl. Acad. Sci. U. S. A. 105, 6714–6719. Umberger, N.L., Caspary, T., 2015. Ciliary transport regulates PDGF-AA/αα signaling via elevated mammalian target of rapamycin signaling and diminished PP2A activity. Mol. Biol. Cell 26, 350–358. Van de Wetering, M., Cavallo, R., Dooijes, D., Van Beest, M., Van Es, J., Loureiro, J., Ypma, A., Hursh, D., Jones, T., Bejsovec, A., Peifer, M., Mortin, M., Clevers, H., 1997. Armadillo coactivates transcription driven by the product of the Drosophila segment polarity gene dTCF. Cell 88, 789–799. Veland, I.R., Montjean, R., Eley, L., Pedersen, L.B., Schwab, A., Goodship, J., Kristiansen, K., Pedersen, S.F., Saunier, S., Christensen, S.T., 2013. Inversin/Nephrocystin-2 Is Required for Fibroblast Polarity and Directional Cell Migration. PLoS One 8. Villari, G., Jayo, A., Zanet, J., Fitch, B., Serrels, B., Frame, M., Stramer, B.M., Goult, B.T., Parsons, M., 2015. A direct interaction between fascin and microtubules contributes to adhesion dynamics and cell migration. J. Cell Sci. 128, 4601–4614. Volz, A.K., Frei, A., Kretschmer, V., de Jesus Domingues, A.M., Ketting, R.F., Ueffing, M., Boldt, K., Krämer-Albers, E.M., May-Simera, H.L., 2021. Bardet-Biedl syndrome proteins modulate the release of bioactive extracellular vesicles. Nat. Commun. 12. Wang, G., Hu, H. Bin, Chang, Y., Huang, Y., Song, Z.Q., Zhou, S.B., Chen, L., Zhang, Y.C., Wu, M., Tu, H.Q., Yuan, J.F., Wang, N., Pan, X., Li, A.L., Zhou, T., Zhang, X.M., He, K., Li, H.Y., 2019. Rab7 regulates primary cilia disassembly through cilia excision. J. Cell Biol. 218, 4030–4041. Wang, Q., Zhou, Y., Rychahou, P., Liu, C., Weiss, H.L., Evers, B.M., 2013. NFAT5 represses canonical Wnt signaling via inhibition of β-catenin acetylation and participates in regulating intestinal cell differentiation. Cell Death Dis. 4. 67 References Wang, Y., Naturale, V.F., Adler, P.N., 2017. Planar cell polarity effector fritz interacts with dishevelled and has multiple functions in regulating PCP. G3 Genes, Genomes, Genet. 7, 1323–1337. Wei, Q., Zhang, Y., Li, Y., Zhang, Q., Ling, K., Hu, J., 2012. The BBSome controls IFT assembly and turnaround in cilia. Nat. Cell Biol. 14, 950–957. Werner, M.E., Ward, H.H., Phillips, C.L., Miller, C., Gattone, V.H., Bacallao, R.L., 2013. Inversin modulates the cortical actin network during mitosis. Am. J. Physiol. - Cell Physiol. 305, 36–47. Wheway, G., Lord, J., Baralle, D., 2019. Splicing in the pathogenesis, diagnosis and treatment of ciliopathies. Biochim. Biophys. Acta - Gene Regul. Mech. Willert, K., Brown, J.D., Danenberg, E., Duncan, A.W., Weissman, I.L., Reya, T., Yates, J.R., Nusse, R., 2003. Wnt proteins are lipid-modified and can act as stem cell growth factors. Nature 423, 448–452. Wolf, D., Rodova, M., Miska, E.A., Calvet, J.P., Kouzarides, T., 2002. Acetylation of β-catenin by CREB-binding protein (CBP). J. Biol. Chem. 277, 25562–25567. Wood, C.R., Wang, Z., Diener, D., Zones, J.M., Rosenbaum, J., Umen, J.G., 2012. IFT Proteins Accumulate during Cell Division and Localize to the Cleavage Furrow in Chlamydomonas. PLoS One 7, e30729. Wormser, O., Gradstein, L., Yogev, Y., Perez, Y., Kadir, R., Goliand, I., Sadka, Y., El Riati, S., Flusser, H., Nachmias, D., Birk, R., Iraqi, M., Kadar, E., Gat, R., Drabkin, M., Halperin, D., Horev, A., Sivan, S., Abdu, U., Elia, N., Birk, O.S., 2019. SCAPER localizes to primary cilia and its mutation affects cilia length, causing Bardet-Biedl syndrome. Eur. J. Hum. Genet. 27, 928–940. Wu, C.T., Chen, H.Y., Tang, T.K., 2018. Myosin-Va is required for preciliary vesicle transportation to the mother centriole during ciliogenesis. Nat. Cell Biol. 20, 175–185. Wu, G., He, X., 2006. Threonine 41 in β-catenin serves as a key phosphorylation relay residue in β-catenin degradation. Biochemistry 45, 5319–5323. Xu, J., Deng, X., Wu, X., Zhu, H., Zhu, Y., Liu, J., Chen, Q., Yuan, C., Liu, G., Wang, C., 2021. Primary cilia regulate gastric cancer-induced bone loss via cilia/Wnt/p-catenin signaling pathway. Aging (Albany. NY). 13, 8989–9010. 68 References Xu, S., Gotlieb, A.I., 2013. Wnt3a/β-catenin increases proliferation in heart valve interstitial cells. Cardiovasc. Pathol. 22, 156–166. Xue, B., Liu, Y.X., Dong, B., Wingfield, J.L., Wu, M., Sun, J., Lechtreck, K.F., Fan, Z.C., 2020. Intraflagellar transport protein RABL5/IFT22 recruits the BBSome to the basal body through the GTPase ARL6/BBS3. Proc. Natl. Acad. Sci. U. S. A. 117, 2496–2505. Yanagawa, S.I., Matsuda, Y., Lee, J.S., Matsubayashi, H., Sese, S., Kadowaki, T., Ishimoto, A., 2002. Casein kinase I phosphorylates the Armadillo protein and induces its degradation in Drosophila. EMBO J. 21, 1733–1742. Yang, M., Waterman, M.L., Brachmann, R.K., 2008. hADA2a and hADA3 are required for acetylation, transcriptional activity and proliferative effects of β-catenin. Cancer Biol. Ther. 7, 122–130. Yang, T.T., Chong, W.M., Wang, W.J., Mazo, G., Tanos, B., Chen, Z., Tran, T.M.N., Chen, Y. De, Weng, R.R., Huang, C.E., Jane, W.N., Tsou, M.F.B., Liao, J.C., 2018. Super- resolution architecture of mammalian centriole distal appendages reveals distinct blade and matrix functional components. Nat. Commun. 9, 2023. Ye, F., Nager, A.R., Nachury, M. V., 2018. BBSome trains remove activated GPCRs from cilia by enabling passage through the transition zone. J. Cell Biol. 217, 1847–1868. Yen, H.J., Tayeh, M.K., Mullins, R.F., Stone, E.M., Sheffield, V.C., Slusarski, D.C., 2006. Bardet-Biedl syndrome genes are important in retrograde intracellular trafficking and Kupffer’s vesicle cilia function. Hum. Mol. Genet. 15, 667–677. Yildirim, A., Mozaffari-Jovin, S., Wallisch, A.K., Schäfer, J., Ludwig, S.E.J., Urlaub, H., Lührmann, R., Wolfrum, U., 2021. SANS (USH1G) regulates pre-mRNA splicing by mediating the intra-nuclear transfer of tri-snRNP complexes. Nucleic Acids Res. 49, 5845–5866. Yin, Y., Bangs, F., Paton, I.R., Prescott, A., James, J., Davey, M.G., Whitley, P., Genikhovich, G., Technau, U., Burt, D.W., Tickle, C., 2009. The Talpid3 gene (KIAA0586) encodes a centrosomal protein that is essential for primary cilia formation. Development 136, 655– 664. 69 References Yost, C., Torres, M., Miller, J.R., Huang, E., Kimelman, D., Moon, R.T., 1996. The axis- inducing activity, stability, and subcellular distribution of β-catenin is regulated in Xenopus embryos by glycogen synthase kinase 3. Genes Dev. 10, 1443–1454. Zanet, J., Jayo, A., Plaza, S., Millard, T., Parsons, M., Stramer, B., 2012. Fascin promotes filopodia formation independent of its role in actin bundling. J. Cell Biol. 197, 477–486. Zhang, Q., Yu, D., Seo, S., Stone, E.M., Sheffield, V.C., 2012. Intrinsic protein-protein interaction-mediated and chaperonin-assisted sequential assembly of stable Bardet-Biedl syndrome protein complex, the BBSome. J. Biol. Chem. 287, 20625–20635. 70 Supplements 8. Supplements 8.1. Contribution to Publications This thesis is composed of three publications and one manuscript. In the following section, my contribution to each publication will be explained in more detail. Publication I consists of the analysis of gene expression of Bbs genes in different mouse tissues. For this publication, I isolated the RNA out of mouse tissues and generated cDNA. Furthermore, I helped in doing RT-qPCR of selected Bbs genes that was mainly performed by S. P.. In Publication II, the function of BBS proteins during Wnt signalling and ciliary disassembly is described. My part included performing the interaction studies (GFP traps) between the BBS proteins BBS2/BBS6 and the Wnt regulator Inversin. Furthermore, I analysed the ciliary localisation of Inversin in wildtype and Bbs6 depleted mouse kidney medullary cells and did the quantification and analysis of the resulting immunofluorescence pictures. I also helped S. P. with western blots analysing the protein HEF1 in Bbs8 depleted and MG132 treated cells. Manuscript I describes the role of BBS proteins in filopodia regulations via interaction with Fascin-1 and the potential ciliary function of Fascin-1. Most of these data were acquired by me or S. B., who worked under my supervision. I have also written the complete manuscript and performed literature research. For analysing filopodia length, I performed live cell imaging of Bbs6, Bbs8 and Inversin depleted MEFs. I analysed the resulting videos of Bbs6 and Inversin depleted cells, whereas S. B. did the analysis of Bbs8 MEFs. I performed immunofluorescence stainings of endogenous and overexpressed Fascin-1 in MEFs and investigated the interaction between Fascin-1 and Inversin and BBS6/BBS8 via GFP traps. I isolated protein out of Bbs6 depleted MEFs and S. B. and I performed western blots of different proteins. The analysis of Bbs6 in ubiquitination of Fascin-1 including co-immunoprecipitations was also performed by me. I performed siRNA transfections for Fascin-1 in MEFs and S. B. and I were both involved in the subsequent RNA isolation, cDNA synthesis and RT-qPCR analysis. Under my supervision, S. B. performed knockdown of Fascin-1 in wildtype and Bbs6 depleted MEFs and analysed cilia numbers and 71 Supplements length. S. B. further validated the knockdown of Fascin-1 via immunofluorescence and investigated the ciliary localisation of Fascin-1 mutations. Publication III is a literature review on the interplay between cilia and actin. I did the literature research and writing of this manuscript while V. K. created the figures. I further provided an immunofluorescence image showing the actin cytoskeleton and cilia markers for figure 1. 72 Supplements 8.2. Abbreviations ALMS Alström syndrome APC Adenomatous polyposis coli ARF ADP-ribosylation factor ARL6 ADP-ribosylation factor-like protein 6 BB Basal body BBIP1 BBSome-interacting protein 1 BBS Bardet-Biedl syndrome BCL9 B‐cell lymphoma 9 C8orf37 Chromosome 8 open reading frame 37 protein CBP CREB‐binding protein CCT Chaperonin containing TCP-1 CEP Centrosomal protein CK1 Casein kinase 1 Cobl Cordon-Bleu WH2 Repeat Protein CP Ciliary pocket DA Distal appendage DAAM1 Dishevelled-associated activator of morphogenesis 1 DNA Desoxyribonucleic acid DVL Dishevelled ER Endoplasmic reticulum F-actin Filamentous actin FAK Focal adhesion kinase FZD Frizzled 73 Supplements GSK3β Glycogensynthase kinase 3β GTP Guanosine triphosphate JNK c-Jun N-terminal kinase JUN c-Jun IFT Intraflagellar transport JATD Jeune syndrome JBTS Joubert syndrome LCA Leber Congenital Amaurosis LEF Lymphoid enhancer‐binding factor LRP Low‐density lipoprotein receptor‐related protein LZTFL1 Leucine zipper transcription factor-like protein 1 MACF1 Microtubule and actin crosslinking factor 1 mTOR mammalian Target of rapamycin MKKS McKusick–Kaufman syndrome MKS Meckel syndrome NPHP Nephrocystins/Nephronophthisis OFD1 Oro-facial-digital syndrome type 1 P Phosphorylation PCP Planar cell polarity PDGF Platelet-derived growth factor PM Plasma membrane Pygo Pygopus RHOA Ras homolog family member A ROCK Rho-associated, coiled-coil-containing protein kinase 74 Supplements SCF Skp1-Cullin1-F-box SDA Subdistal appendage SDCCAG8 Serologically defined colon cancer antigen 8 Shh Sonic hedgehog SLS Senior-Loken syndrome TCF T-cell factor TGFβ Transforming growth factor β TriC T-complex protein-1 ring complex TRIM32 Tripartite motif containing 32 TTC8 Tetratricopeptide repeat domain protein 8 Wash Wiskott–Aldrich syndrome protein and SCAR homologue WDPCP WD repeat containing planar cell polarity effector protein 8.3. Index of Figures Fig. 1: The intracellular process of ciliogenesis. ........................................................................ 3 Fig. 2: The actin cytoskeleton. ................................................................................................... 4 Fig. 3: BBSome assembly and IFT transport. .......................................................................... 10 Fig. 4: The Wnt signalling pathway. ........................................................................................ 13 Fig. 5: BBS proteins affect ciliogenesis via regulation of Inversin. ........................................ 31 Fig. 6: Fascin-1 and BBS6 do not completely colocalise at primary cilia. .............................. 37 Fig. 7: Loss of Inversin affects filopodia. ................................................................................ 40 Fig. 8: Possible mechanisms for Fascin-1 in ciliary regulations. ............................................. 41 8.4. Index of Tables Table 1: Selected ciliopathies and overlapping syndromic features. ......................................... 6 Table 2: BBS proteins, related functions and cellular localisation. ........................................... 7 75 Supplements 8.5. Acknowledgements 76 Supplements 8.6. Curriculum vitae 77 Supplements 78 Supplements 8.7. Declaration of honour I declare that I have written the present thesis on my own while using only the given methods. I have not handed in this thesis at another faculty or university before and I have not attempted to reach the academic degree Dr. rer. nat. before. I certify that all information contained in this application is correct to the best of my knowledge. Mainz, Lena Brücker 79